FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622977_at:

>probe:Drosophila_2:1622977_at:221:611; Interrogation_Position=108; Antisense; TGACCTGGACGATGAGGCGCCCGAT
>probe:Drosophila_2:1622977_at:520:347; Interrogation_Position=150; Antisense; GCAGACCCGCAAGTGGAACGATCTT
>probe:Drosophila_2:1622977_at:307:383; Interrogation_Position=165; Antisense; GAACGATCTTTCTATGCCACAGCGA
>probe:Drosophila_2:1622977_at:220:123; Interrogation_Position=185; Antisense; AGCGACACGATTCGTTTCCAGTTCC
>probe:Drosophila_2:1622977_at:226:121; Interrogation_Position=219; Antisense; AGCTGGATCTCCATCAACGGGCTAC
>probe:Drosophila_2:1622977_at:412:139; Interrogation_Position=267; Antisense; ACGGGTCTCCTACGAAGCCTTGGAG
>probe:Drosophila_2:1622977_at:77:207; Interrogation_Position=27; Antisense; AAGCGACTTGTTTGCCTGTATCAGG
>probe:Drosophila_2:1622977_at:423:417; Interrogation_Position=289; Antisense; GAGCGCTACGATCGAATTTTTGGCA
>probe:Drosophila_2:1622977_at:154:585; Interrogation_Position=309; Antisense; TGGCAGATCTTTCCAAGACGCCGGG
>probe:Drosophila_2:1622977_at:346:305; Interrogation_Position=329; Antisense; CCGGGTCATCTGGTTCAGTTCGAAA
>probe:Drosophila_2:1622977_at:650:469; Interrogation_Position=346; Antisense; GTTCGAAATATTCCCGACCAGTTCT
>probe:Drosophila_2:1622977_at:667:471; Interrogation_Position=44; Antisense; GTATCAGGGCCCAGGGAAATTCCGA
>probe:Drosophila_2:1622977_at:92:395; Interrogation_Position=59; Antisense; GAAATTCCGACACGGATTCCACCAG
>probe:Drosophila_2:1622977_at:515:41; Interrogation_Position=92; Antisense; ATCGGCGGAATATCGCTGACCTGGA

Paste this into a BLAST search page for me
TGACCTGGACGATGAGGCGCCCGATGCAGACCCGCAAGTGGAACGATCTTGAACGATCTTTCTATGCCACAGCGAAGCGACACGATTCGTTTCCAGTTCCAGCTGGATCTCCATCAACGGGCTACACGGGTCTCCTACGAAGCCTTGGAGAAGCGACTTGTTTGCCTGTATCAGGGAGCGCTACGATCGAATTTTTGGCATGGCAGATCTTTCCAAGACGCCGGGCCGGGTCATCTGGTTCAGTTCGAAAGTTCGAAATATTCCCGACCAGTTCTGTATCAGGGCCCAGGGAAATTCCGAGAAATTCCGACACGGATTCCACCAGATCGGCGGAATATCGCTGACCTGGA

Full Affymetrix probeset data:

Annotations for 1622977_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720