FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622978_at:

>probe:Drosophila_2:1622978_at:440:393; Interrogation_Position=573; Antisense; GAAAGGCTAGCAAAGGACGTACCAA
>probe:Drosophila_2:1622978_at:287:571; Interrogation_Position=577; Antisense; GGCTAGCAAAGGACGTACCAAGAAT
>probe:Drosophila_2:1622978_at:113:675; Interrogation_Position=580; Antisense; TAGCAAAGGACGTACCAAGAATTAA
>probe:Drosophila_2:1622978_at:457:11; Interrogation_Position=600; Antisense; ATTAAAAACCATTTGACATTGCCTA
>probe:Drosophila_2:1622978_at:225:173; Interrogation_Position=605; Antisense; AAACCATTTGACATTGCCTAATCGG
>probe:Drosophila_2:1622978_at:660:305; Interrogation_Position=608; Antisense; CCATTTGACATTGCCTAATCGGTTT
>probe:Drosophila_2:1622978_at:183:721; Interrogation_Position=618; Antisense; TTGCCTAATCGGTTTCTTTTTAGCT
>probe:Drosophila_2:1622978_at:561:313; Interrogation_Position=620; Antisense; GCCTAATCGGTTTCTTTTTAGCTCT
>probe:Drosophila_2:1622978_at:352:655; Interrogation_Position=623; Antisense; TAATCGGTTTCTTTTTAGCTCTTAT
>probe:Drosophila_2:1622978_at:406:39; Interrogation_Position=625; Antisense; ATCGGTTTCTTTTTAGCTCTTATCG
>probe:Drosophila_2:1622978_at:339:289; Interrogation_Position=627; Antisense; CGGTTTCTTTTTAGCTCTTATCGAT
>probe:Drosophila_2:1622978_at:25:479; Interrogation_Position=629; Antisense; GTTTCTTTTTAGCTCTTATCGATAT
>probe:Drosophila_2:1622978_at:216:705; Interrogation_Position=637; Antisense; TTAGCTCTTATCGATATTATATACG
>probe:Drosophila_2:1622978_at:557:335; Interrogation_Position=640; Antisense; GCTCTTATCGATATTATATACGAAC

Paste this into a BLAST search page for me
GAAAGGCTAGCAAAGGACGTACCAAGGCTAGCAAAGGACGTACCAAGAATTAGCAAAGGACGTACCAAGAATTAAATTAAAAACCATTTGACATTGCCTAAAACCATTTGACATTGCCTAATCGGCCATTTGACATTGCCTAATCGGTTTTTGCCTAATCGGTTTCTTTTTAGCTGCCTAATCGGTTTCTTTTTAGCTCTTAATCGGTTTCTTTTTAGCTCTTATATCGGTTTCTTTTTAGCTCTTATCGCGGTTTCTTTTTAGCTCTTATCGATGTTTCTTTTTAGCTCTTATCGATATTTAGCTCTTATCGATATTATATACGGCTCTTATCGATATTATATACGAAC

Full Affymetrix probeset data:

Annotations for 1622978_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720