Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622979_a_at:

>probe:Drosophila_2:1622979_a_at:196:389; Interrogation_Position=1052; Antisense; GAAAACAGAATGAACGCCGCCAGAA
>probe:Drosophila_2:1622979_a_at:129:151; Interrogation_Position=1121; Antisense; ACATCTGACACGGATTTTGGAGGCA
>probe:Drosophila_2:1622979_a_at:77:589; Interrogation_Position=1138; Antisense; TGGAGGCAGATTTCTCATTCTAGAA
>probe:Drosophila_2:1622979_a_at:140:49; Interrogation_Position=1187; Antisense; ATGCCGTGTACATTTGGCTTTAAAT
>probe:Drosophila_2:1622979_a_at:285:283; Interrogation_Position=686; Antisense; CTGCTGAGTCTCTTTAACATGGTCT
>probe:Drosophila_2:1622979_a_at:72:189; Interrogation_Position=701; Antisense; AACATGGTCTTCAAGTCCTACTTCG
>probe:Drosophila_2:1622979_a_at:653:503; Interrogation_Position=715; Antisense; GTCCTACTTCGTGCAAGTGACTCAA
>probe:Drosophila_2:1622979_a_at:510:83; Interrogation_Position=730; Antisense; AGTGACTCAACTTTACGTCGGCGTT
>probe:Drosophila_2:1622979_a_at:625:139; Interrogation_Position=744; Antisense; ACGTCGGCGTTTTCGTTATGGCTGC
>probe:Drosophila_2:1622979_a_at:8:69; Interrogation_Position=761; Antisense; ATGGCTGCCTTCATCGTCTACGATA
>probe:Drosophila_2:1622979_a_at:297:509; Interrogation_Position=830; Antisense; GTGCAGCACGCTTTAGATTTGTTCT
>probe:Drosophila_2:1622979_a_at:589:459; Interrogation_Position=845; Antisense; GATTTGTTCTTCGATGTACTCAGCA
>probe:Drosophila_2:1622979_a_at:505:59; Interrogation_Position=858; Antisense; ATGTACTCAGCATGTTCCGCCGTTT
>probe:Drosophila_2:1622979_a_at:81:633; Interrogation_Position=873; Antisense; TCCGCCGTTTGCTGATTATACTGAC

Paste this into a BLAST search page for me
GAAAACAGAATGAACGCCGCCAGAAACATCTGACACGGATTTTGGAGGCATGGAGGCAGATTTCTCATTCTAGAAATGCCGTGTACATTTGGCTTTAAATCTGCTGAGTCTCTTTAACATGGTCTAACATGGTCTTCAAGTCCTACTTCGGTCCTACTTCGTGCAAGTGACTCAAAGTGACTCAACTTTACGTCGGCGTTACGTCGGCGTTTTCGTTATGGCTGCATGGCTGCCTTCATCGTCTACGATAGTGCAGCACGCTTTAGATTTGTTCTGATTTGTTCTTCGATGTACTCAGCAATGTACTCAGCATGTTCCGCCGTTTTCCGCCGTTTGCTGATTATACTGAC

Full Affymetrix probeset data:

Annotations for 1622979_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime