Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622980_at:

>probe:Drosophila_2:1622980_at:656:399; Interrogation_Position=1206; Antisense; GACAGCGCAATTCCATCCTGATGGT
>probe:Drosophila_2:1622980_at:619:435; Interrogation_Position=1225; Antisense; GATGGTCTGATCTTCGGTACGGGCA
>probe:Drosophila_2:1622980_at:437:561; Interrogation_Position=1246; Antisense; GGCACCGTGGACTCGCAGGTTAAGA
>probe:Drosophila_2:1622980_at:540:229; Interrogation_Position=1294; Antisense; AATGTGGCCAACTTCCCTGGTCATA
>probe:Drosophila_2:1622980_at:146:637; Interrogation_Position=1345; Antisense; TCGGAGAACGGTTACTACCTGGCCA
>probe:Drosophila_2:1622980_at:299:447; Interrogation_Position=1381; Antisense; GATGCCTGCGTTAAGCTGTGGGATC
>probe:Drosophila_2:1622980_at:355:397; Interrogation_Position=1428; Antisense; GACAATCCAGCTTGATGACGGCTAC
>probe:Drosophila_2:1622980_at:438:653; Interrogation_Position=1457; Antisense; TCAAGGATCTGTGCTTCGACCAAAG
>probe:Drosophila_2:1622980_at:11:205; Interrogation_Position=1479; Antisense; AAGCGGAACCTATCTGGCTATCGCC
>probe:Drosophila_2:1622980_at:94:317; Interrogation_Position=1501; Antisense; GCCGGCAGCGATGTCAGGGTTTACC
>probe:Drosophila_2:1622980_at:493:523; Interrogation_Position=1517; Antisense; GGGTTTACCTGTGCAAGCAGTGGCA
>probe:Drosophila_2:1622980_at:410:511; Interrogation_Position=1585; Antisense; GTGAGATTCGGCAAGCACGCCCAGT
>probe:Drosophila_2:1622980_at:360:671; Interrogation_Position=1648; Antisense; TACGCCATCGAATAAGTCCACACTT
>probe:Drosophila_2:1622980_at:556:239; Interrogation_Position=1744; Antisense; GAATAATAAACCTGACCCTCTATCC

Paste this into a BLAST search page for me
GACAGCGCAATTCCATCCTGATGGTGATGGTCTGATCTTCGGTACGGGCAGGCACCGTGGACTCGCAGGTTAAGAAATGTGGCCAACTTCCCTGGTCATATCGGAGAACGGTTACTACCTGGCCAGATGCCTGCGTTAAGCTGTGGGATCGACAATCCAGCTTGATGACGGCTACTCAAGGATCTGTGCTTCGACCAAAGAAGCGGAACCTATCTGGCTATCGCCGCCGGCAGCGATGTCAGGGTTTACCGGGTTTACCTGTGCAAGCAGTGGCAGTGAGATTCGGCAAGCACGCCCAGTTACGCCATCGAATAAGTCCACACTTGAATAATAAACCTGACCCTCTATCC

Full Affymetrix probeset data:

Annotations for 1622980_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime