FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622981_at:

>probe:Drosophila_2:1622981_at:729:425; Interrogation_Position=1904; Antisense; GAGTAGGGTCCCGACTCTAAAGTCT
>probe:Drosophila_2:1622981_at:534:291; Interrogation_Position=1933; Antisense; CGTTCTCCATCCGAAAAATGTTTCA
>probe:Drosophila_2:1622981_at:549:167; Interrogation_Position=1948; Antisense; AAATGTTTCATTGTGATTGCGTTTG
>probe:Drosophila_2:1622981_at:32:465; Interrogation_Position=1962; Antisense; GATTGCGTTTGTTTGCATTTCTCCT
>probe:Drosophila_2:1622981_at:375:693; Interrogation_Position=1969; Antisense; TTTGTTTGCATTTCTCCTCTCTATC
>probe:Drosophila_2:1622981_at:656:643; Interrogation_Position=1988; Antisense; TCTATCCCTTATACCCTACAAAAGC
>probe:Drosophila_2:1622981_at:249:97; Interrogation_Position=2107; Antisense; AGATGAAGATTAGCCTCCTCGACGT
>probe:Drosophila_2:1622981_at:473:623; Interrogation_Position=2122; Antisense; TCCTCGACGTTTATGTCCCAGTAAA
>probe:Drosophila_2:1622981_at:380:187; Interrogation_Position=2186; Antisense; AACACGAACGAGAAAATGCACACAA
>probe:Drosophila_2:1622981_at:600:343; Interrogation_Position=2280; Antisense; GCATAGTTATGATCTACAGACGTAT
>probe:Drosophila_2:1622981_at:617:663; Interrogation_Position=2325; Antisense; TAAATATATATGTCAGCAGGCGCAT
>probe:Drosophila_2:1622981_at:416:69; Interrogation_Position=2342; Antisense; AGGCGCATATCTGCGGTGCTGGCCC
>probe:Drosophila_2:1622981_at:196:285; Interrogation_Position=2360; Antisense; CTGGCCCCGTTCTAAATCAATTGTA
>probe:Drosophila_2:1622981_at:509:51; Interrogation_Position=2427; Antisense; ATGCGAGATACAAAAATCACCGACG

Paste this into a BLAST search page for me
GAGTAGGGTCCCGACTCTAAAGTCTCGTTCTCCATCCGAAAAATGTTTCAAAATGTTTCATTGTGATTGCGTTTGGATTGCGTTTGTTTGCATTTCTCCTTTTGTTTGCATTTCTCCTCTCTATCTCTATCCCTTATACCCTACAAAAGCAGATGAAGATTAGCCTCCTCGACGTTCCTCGACGTTTATGTCCCAGTAAAAACACGAACGAGAAAATGCACACAAGCATAGTTATGATCTACAGACGTATTAAATATATATGTCAGCAGGCGCATAGGCGCATATCTGCGGTGCTGGCCCCTGGCCCCGTTCTAAATCAATTGTAATGCGAGATACAAAAATCACCGACG

Full Affymetrix probeset data:

Annotations for 1622981_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720