Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622982_at:

>probe:Drosophila_2:1622982_at:489:643; Interrogation_Position=1245; Antisense; TCTTCAGCGAGGTGACGGCCTTCAA
>probe:Drosophila_2:1622982_at:704:169; Interrogation_Position=1301; Antisense; AAAGAGCAGTAATCCCGGCCGCCAT
>probe:Drosophila_2:1622982_at:624:633; Interrogation_Position=1325; Antisense; TCCCTCTCCGTTCAATGATGCTATA
>probe:Drosophila_2:1622982_at:304:107; Interrogation_Position=1357; Antisense; AGAACAGTCTTTTCTACACCTAGTT
>probe:Drosophila_2:1622982_at:110:667; Interrogation_Position=1371; Antisense; TACACCTAGTTCAAGCGGATGCGCT
>probe:Drosophila_2:1622982_at:618:447; Interrogation_Position=1388; Antisense; GATGCGCTCAGTCGTGATTTCTCTA
>probe:Drosophila_2:1622982_at:28:515; Interrogation_Position=1401; Antisense; GTGATTTCTCTACTCGTCGAGTGTA
>probe:Drosophila_2:1622982_at:59:391; Interrogation_Position=1465; Antisense; GAAACTCTTCAGTGGCTGGATTTCA
>probe:Drosophila_2:1622982_at:685:379; Interrogation_Position=1538; Antisense; GAACCTTCGATTTGCATTCGATGGA
>probe:Drosophila_2:1622982_at:369:533; Interrogation_Position=1585; Antisense; GGTGCATGCCTGAAATGTAGCCATT
>probe:Drosophila_2:1622982_at:334:495; Interrogation_Position=1637; Antisense; GTCACAGCCTTAATGTCCAGTTCAA
>probe:Drosophila_2:1622982_at:645:399; Interrogation_Position=1675; Antisense; GTCGGTTTTAACACGCAGTTCTTGT
>probe:Drosophila_2:1622982_at:566:205; Interrogation_Position=1744; Antisense; AAGCGAACGCATCTAGCGGCCAGTA
>probe:Drosophila_2:1622982_at:86:357; Interrogation_Position=1782; Antisense; GCACTAGTGTCTACGTTGAATCCAA

Paste this into a BLAST search page for me
TCTTCAGCGAGGTGACGGCCTTCAAAAAGAGCAGTAATCCCGGCCGCCATTCCCTCTCCGTTCAATGATGCTATAAGAACAGTCTTTTCTACACCTAGTTTACACCTAGTTCAAGCGGATGCGCTGATGCGCTCAGTCGTGATTTCTCTAGTGATTTCTCTACTCGTCGAGTGTAGAAACTCTTCAGTGGCTGGATTTCAGAACCTTCGATTTGCATTCGATGGAGGTGCATGCCTGAAATGTAGCCATTGTCACAGCCTTAATGTCCAGTTCAAGTCGGTTTTAACACGCAGTTCTTGTAAGCGAACGCATCTAGCGGCCAGTAGCACTAGTGTCTACGTTGAATCCAA

Full Affymetrix probeset data:

Annotations for 1622982_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime