FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622984_at:

>probe:Drosophila_2:1622984_at:629:651; Interrogation_Position=397; Antisense; TCAACCACACCATCTTCTGGCAGAA
>probe:Drosophila_2:1622984_at:156:105; Interrogation_Position=436; Antisense; AGACCCAGCCCAGCGATGATCTGAA
>probe:Drosophila_2:1622984_at:204:111; Interrogation_Position=460; Antisense; AGAAGGCCATCGAGTCGCAGTGGAA
>probe:Drosophila_2:1622984_at:713:573; Interrogation_Position=549; Antisense; GGCTGGCTGGGCTTCAACAAGAAGT
>probe:Drosophila_2:1622984_at:60:219; Interrogation_Position=570; Antisense; AAGTCGGGCAAACTGCAACTGGCCG
>probe:Drosophila_2:1622984_at:701:715; Interrogation_Position=645; Antisense; TTCGGCATCGATGTCTGGGAGCACG
>probe:Drosophila_2:1622984_at:320:529; Interrogation_Position=661; Antisense; GGGAGCACGCCTACTATCTGCAGTA
>probe:Drosophila_2:1622984_at:134:619; Interrogation_Position=679; Antisense; TGCAGTACAAGAACGTGCGTCCCTC
>probe:Drosophila_2:1622984_at:525:587; Interrogation_Position=709; Antisense; TGGAGGCCATCTGGGACATCGCCAA
>probe:Drosophila_2:1622984_at:64:197; Interrogation_Position=732; Antisense; AACTGGGATGACATCTCGTGCCGCT
>probe:Drosophila_2:1622984_at:179:547; Interrogation_Position=761; Antisense; GGAGGCCAAGAAGCTCGGTTGCTAA
>probe:Drosophila_2:1622984_at:696:467; Interrogation_Position=778; Antisense; GTTGCTAAGCACAGCCGGCGATTGC
>probe:Drosophila_2:1622984_at:361:305; Interrogation_Position=792; Antisense; CCGGCGATTGCGTATGTTTAATCTA
>probe:Drosophila_2:1622984_at:109:659; Interrogation_Position=817; Antisense; TAAGCATCTGCGGATCGGAGATCCT

Paste this into a BLAST search page for me
TCAACCACACCATCTTCTGGCAGAAAGACCCAGCCCAGCGATGATCTGAAAGAAGGCCATCGAGTCGCAGTGGAAGGCTGGCTGGGCTTCAACAAGAAGTAAGTCGGGCAAACTGCAACTGGCCGTTCGGCATCGATGTCTGGGAGCACGGGGAGCACGCCTACTATCTGCAGTATGCAGTACAAGAACGTGCGTCCCTCTGGAGGCCATCTGGGACATCGCCAAAACTGGGATGACATCTCGTGCCGCTGGAGGCCAAGAAGCTCGGTTGCTAAGTTGCTAAGCACAGCCGGCGATTGCCCGGCGATTGCGTATGTTTAATCTATAAGCATCTGCGGATCGGAGATCCT

Full Affymetrix probeset data:

Annotations for 1622984_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720