FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622985_at:

>probe:Drosophila_2:1622985_at:393:149; Interrogation_Position=1011; Antisense; ACTTCAGGTCATGCCCATCAAGGAG
>probe:Drosophila_2:1622985_at:76:605; Interrogation_Position=1091; Antisense; TGATTTGCCAACACACGAGCCTGTT
>probe:Drosophila_2:1622985_at:57:97; Interrogation_Position=1122; Antisense; AGATCTGTCGAATAATTCCTTGGGA
>probe:Drosophila_2:1622985_at:231:253; Interrogation_Position=1188; Antisense; CAAGCTTCTTGAGAGGTTGGACCTT
>probe:Drosophila_2:1622985_at:106:377; Interrogation_Position=1284; Antisense; GAAGCACGAGGCCTTGAAGCAAAAG
>probe:Drosophila_2:1622985_at:342:663; Interrogation_Position=759; Antisense; TAAAGGATGTCACCATCTGACCGAA
>probe:Drosophila_2:1622985_at:603:271; Interrogation_Position=772; Antisense; CATCTGACCGAAATGTCCTTGCTGC
>probe:Drosophila_2:1622985_at:538:367; Interrogation_Position=818; Antisense; GAATCCGCTGCTTCTTGGAGACGTG
>probe:Drosophila_2:1622985_at:525:565; Interrogation_Position=844; Antisense; GGCAAGGAGTCCTTCGGCACTCTCA
>probe:Drosophila_2:1622985_at:73:645; Interrogation_Position=864; Antisense; TCTCACTGTCCTCGATTTGACTAAT
>probe:Drosophila_2:1622985_at:263:707; Interrogation_Position=912; Antisense; TTACATTCTTAGTCGCACCCTGAGG
>probe:Drosophila_2:1622985_at:69:349; Interrogation_Position=936; Antisense; GCATGTTCCCCTCGAGAAACTGGTG
>probe:Drosophila_2:1622985_at:350:391; Interrogation_Position=951; Antisense; GAAACTGGTGCTTCGCTTGAATCCC
>probe:Drosophila_2:1622985_at:101:171; Interrogation_Position=980; Antisense; AAAGTGACGGAGCTGCGGCCATCTT

Paste this into a BLAST search page for me
ACTTCAGGTCATGCCCATCAAGGAGTGATTTGCCAACACACGAGCCTGTTAGATCTGTCGAATAATTCCTTGGGACAAGCTTCTTGAGAGGTTGGACCTTGAAGCACGAGGCCTTGAAGCAAAAGTAAAGGATGTCACCATCTGACCGAACATCTGACCGAAATGTCCTTGCTGCGAATCCGCTGCTTCTTGGAGACGTGGGCAAGGAGTCCTTCGGCACTCTCATCTCACTGTCCTCGATTTGACTAATTTACATTCTTAGTCGCACCCTGAGGGCATGTTCCCCTCGAGAAACTGGTGGAAACTGGTGCTTCGCTTGAATCCCAAAGTGACGGAGCTGCGGCCATCTT

Full Affymetrix probeset data:

Annotations for 1622985_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720