FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622987_at:

>probe:Drosophila_2:1622987_at:521:39; Interrogation_Position=1058; Antisense; ATCTGCACCAGCGATTGCCAGGAAA
>probe:Drosophila_2:1622987_at:103:79; Interrogation_Position=1088; Antisense; AGGATCTAACCCATGGCGACTATGC
>probe:Drosophila_2:1622987_at:116:679; Interrogation_Position=1108; Antisense; TATGCGGCCGTAATGGGTCGGACCA
>probe:Drosophila_2:1622987_at:90:537; Interrogation_Position=1123; Antisense; GGTCGGACCACGTTGCAAGATCTGA
>probe:Drosophila_2:1622987_at:197:453; Interrogation_Position=1168; Antisense; GATCTGCTGGGTCTCAAATCCGTGA
>probe:Drosophila_2:1622987_at:428:165; Interrogation_Position=1183; Antisense; AAATCCGTGATAGTGACCTCTGAAC
>probe:Drosophila_2:1622987_at:458:509; Interrogation_Position=1219; Antisense; GTGCTTCGCACGTTAGATCGGTGTA
>probe:Drosophila_2:1622987_at:324:151; Interrogation_Position=1266; Antisense; ACATCCACTTTTCTTTGGCCTGATT
>probe:Drosophila_2:1622987_at:551:639; Interrogation_Position=1329; Antisense; TCGGGCTGGAGCGTATCACATCATA
>probe:Drosophila_2:1622987_at:489:27; Interrogation_Position=1351; Antisense; ATACCGCAAGACGTTCTGGAGCAGC
>probe:Drosophila_2:1622987_at:720:113; Interrogation_Position=1373; Antisense; AGCAGCTGGCCATTTATCTGCAGAA
>probe:Drosophila_2:1622987_at:711:451; Interrogation_Position=1543; Antisense; GATCTGTGGGCGGTCTACATCCTGA
>probe:Drosophila_2:1622987_at:87:75; Interrogation_Position=1572; Antisense; AGGACTATATCTCCTGTCGCTGGTC
>probe:Drosophila_2:1622987_at:349:501; Interrogation_Position=1594; Antisense; GTCGTCTTCATATGCGAACTTCTGG

Paste this into a BLAST search page for me
ATCTGCACCAGCGATTGCCAGGAAAAGGATCTAACCCATGGCGACTATGCTATGCGGCCGTAATGGGTCGGACCAGGTCGGACCACGTTGCAAGATCTGAGATCTGCTGGGTCTCAAATCCGTGAAAATCCGTGATAGTGACCTCTGAACGTGCTTCGCACGTTAGATCGGTGTAACATCCACTTTTCTTTGGCCTGATTTCGGGCTGGAGCGTATCACATCATAATACCGCAAGACGTTCTGGAGCAGCAGCAGCTGGCCATTTATCTGCAGAAGATCTGTGGGCGGTCTACATCCTGAAGGACTATATCTCCTGTCGCTGGTCGTCGTCTTCATATGCGAACTTCTGG

Full Affymetrix probeset data:

Annotations for 1622987_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720