FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622989_at:

>probe:Drosophila_2:1622989_at:111:205; Interrogation_Position=415; Antisense; AAGCCACTTGTTTGCGGCATCAGCG
>probe:Drosophila_2:1622989_at:348:305; Interrogation_Position=452; Antisense; CCGGTGGATTGGAACTGGCTCTAAT
>probe:Drosophila_2:1622989_at:678:335; Interrogation_Position=469; Antisense; GCTCTAATGTGCGATCTCCGGGTGA
>probe:Drosophila_2:1622989_at:629:471; Interrogation_Position=516; Antisense; GTTCTTCAACCGTCGCCTTGGAGTT
>probe:Drosophila_2:1622989_at:455:615; Interrogation_Position=576; Antisense; TGCAGTGGGTTACTCCAATGCCTTG
>probe:Drosophila_2:1622989_at:515:233; Interrogation_Position=592; Antisense; AATGCCTTGGAGATCATCGCAACTG
>probe:Drosophila_2:1622989_at:167:197; Interrogation_Position=612; Antisense; AACTGGAAGACGCATCTACTCTGGG
>probe:Drosophila_2:1622989_at:297:83; Interrogation_Position=657; Antisense; AGTGAATCGCGTTGTGGCCACAGGC
>probe:Drosophila_2:1622989_at:252:579; Interrogation_Position=672; Antisense; GGCCACAGGCACAGCTTTAGGTCAA
>probe:Drosophila_2:1622989_at:418:537; Interrogation_Position=691; Antisense; GGTCAAGCTGTTAATCTGGCCTTTT
>probe:Drosophila_2:1622989_at:400:237; Interrogation_Position=703; Antisense; AATCTGGCCTTTTCCATTGCCAAGT
>probe:Drosophila_2:1622989_at:296:67; Interrogation_Position=733; Antisense; ATGGCTTCCCTAATGCACGACAGGA
>probe:Drosophila_2:1622989_at:180:175; Interrogation_Position=790; Antisense; AAACCAGGATTCCATGTGGCCAGTT
>probe:Drosophila_2:1622989_at:668:575; Interrogation_Position=898; Antisense; GGCCCCAAAACCGATTCGTGGAGCA

Paste this into a BLAST search page for me
AAGCCACTTGTTTGCGGCATCAGCGCCGGTGGATTGGAACTGGCTCTAATGCTCTAATGTGCGATCTCCGGGTGAGTTCTTCAACCGTCGCCTTGGAGTTTGCAGTGGGTTACTCCAATGCCTTGAATGCCTTGGAGATCATCGCAACTGAACTGGAAGACGCATCTACTCTGGGAGTGAATCGCGTTGTGGCCACAGGCGGCCACAGGCACAGCTTTAGGTCAAGGTCAAGCTGTTAATCTGGCCTTTTAATCTGGCCTTTTCCATTGCCAAGTATGGCTTCCCTAATGCACGACAGGAAAACCAGGATTCCATGTGGCCAGTTGGCCCCAAAACCGATTCGTGGAGCA

Full Affymetrix probeset data:

Annotations for 1622989_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720