FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622990_at:

>probe:Drosophila_2:1622990_at:575:425; Interrogation_Position=1677; Antisense; GAGAGACCCACAAACGATCGCTATA
>probe:Drosophila_2:1622990_at:697:449; Interrogation_Position=1692; Antisense; GATCGCTATAGATCTTCCCTATCGG
>probe:Drosophila_2:1622990_at:594:381; Interrogation_Position=1719; Antisense; GAACGGGAATCGAATTCCACGCCCA
>probe:Drosophila_2:1622990_at:356:133; Interrogation_Position=1737; Antisense; ACGCCCACGCCGAGGATGAGGAAGA
>probe:Drosophila_2:1622990_at:576:77; Interrogation_Position=1840; Antisense; AGGTTTATTTAACGCCCTCATATGC
>probe:Drosophila_2:1622990_at:555:511; Interrogation_Position=1926; Antisense; GTGACATCCGCCAACATATCAGTTA
>probe:Drosophila_2:1622990_at:698:35; Interrogation_Position=1943; Antisense; ATCAGTTAGCACATCGGATACCAAT
>probe:Drosophila_2:1622990_at:369:543; Interrogation_Position=1958; Antisense; GGATACCAATGAACTACCAGGCCAA
>probe:Drosophila_2:1622990_at:16:221; Interrogation_Position=2016; Antisense; AAGGGCCAATTCAGGGAGTCGTCGC
>probe:Drosophila_2:1622990_at:152:323; Interrogation_Position=2039; Antisense; GCCCACTTCATCGAACTTGGATTGG
>probe:Drosophila_2:1622990_at:470:583; Interrogation_Position=2056; Antisense; TGGATTGGAACCCACTACCGAAGCC
>probe:Drosophila_2:1622990_at:113:673; Interrogation_Position=2071; Antisense; TACCGAAGCCAAGTCGAGCGCATAA
>probe:Drosophila_2:1622990_at:95:417; Interrogation_Position=2086; Antisense; GAGCGCATAACTCAGCTAGTTCTAA
>probe:Drosophila_2:1622990_at:696:471; Interrogation_Position=2104; Antisense; GTTCTAACTTCAACAACGGCTCGTG

Paste this into a BLAST search page for me
GAGAGACCCACAAACGATCGCTATAGATCGCTATAGATCTTCCCTATCGGGAACGGGAATCGAATTCCACGCCCAACGCCCACGCCGAGGATGAGGAAGAAGGTTTATTTAACGCCCTCATATGCGTGACATCCGCCAACATATCAGTTAATCAGTTAGCACATCGGATACCAATGGATACCAATGAACTACCAGGCCAAAAGGGCCAATTCAGGGAGTCGTCGCGCCCACTTCATCGAACTTGGATTGGTGGATTGGAACCCACTACCGAAGCCTACCGAAGCCAAGTCGAGCGCATAAGAGCGCATAACTCAGCTAGTTCTAAGTTCTAACTTCAACAACGGCTCGTG

Full Affymetrix probeset data:

Annotations for 1622990_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720