FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622995_at:

>probe:Drosophila_2:1622995_at:34:347; Interrogation_Position=126; Antisense; GCATCAAGCAGAACGCCTCCAAGAT
>probe:Drosophila_2:1622995_at:92:345; Interrogation_Position=153; Antisense; GCATTCGCCGAATGGAGCTGGACAA
>probe:Drosophila_2:1622995_at:670:109; Interrogation_Position=198; Antisense; AGAAGGACGAGTTCTACTTCGCCCA
>probe:Drosophila_2:1622995_at:345:717; Interrogation_Position=215; Antisense; TTCGCCCACGATCCGCAGAAGGTGT
>probe:Drosophila_2:1622995_at:64:605; Interrogation_Position=261; Antisense; TGATACGGGAACTGCCAGAGCGCCT
>probe:Drosophila_2:1622995_at:398:591; Interrogation_Position=318; Antisense; TGGTCTATCCGCTGGGTGACATAAC
>probe:Drosophila_2:1622995_at:262:555; Interrogation_Position=343; Antisense; GGACCCGCTCACTGGCAAGAAGGTG
>probe:Drosophila_2:1622995_at:194:291; Interrogation_Position=370; Antisense; CGTGGGCAATTACCGCGAGGACATC
>probe:Drosophila_2:1622995_at:421:99; Interrogation_Position=396; Antisense; AGATGGCCAACCAGCTGTTCGGCAA
>probe:Drosophila_2:1622995_at:422:689; Interrogation_Position=413; Antisense; TTCGGCAAGTCAGAGAAGGCCTTCG
>probe:Drosophila_2:1622995_at:612:585; Interrogation_Position=468; Antisense; TGGAGGGAACCAAGGACTTCACCCA
>probe:Drosophila_2:1622995_at:188:219; Interrogation_Position=527; Antisense; AAGGATCAGCCGTTCGCCGTTTAGA
>probe:Drosophila_2:1622995_at:4:283; Interrogation_Position=555; Antisense; CTGCCGGTCGTTTATCTGTTAAGTT
>probe:Drosophila_2:1622995_at:543:489; Interrogation_Position=616; Antisense; GTACATATGTTTCTCGGTTTTCTTA

Paste this into a BLAST search page for me
GCATCAAGCAGAACGCCTCCAAGATGCATTCGCCGAATGGAGCTGGACAAAGAAGGACGAGTTCTACTTCGCCCATTCGCCCACGATCCGCAGAAGGTGTTGATACGGGAACTGCCAGAGCGCCTTGGTCTATCCGCTGGGTGACATAACGGACCCGCTCACTGGCAAGAAGGTGCGTGGGCAATTACCGCGAGGACATCAGATGGCCAACCAGCTGTTCGGCAATTCGGCAAGTCAGAGAAGGCCTTCGTGGAGGGAACCAAGGACTTCACCCAAAGGATCAGCCGTTCGCCGTTTAGACTGCCGGTCGTTTATCTGTTAAGTTGTACATATGTTTCTCGGTTTTCTTA

Full Affymetrix probeset data:

Annotations for 1622995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720