FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622996_at:

>probe:Drosophila_2:1622996_at:301:3; Interrogation_Position=2384; Antisense; ATTGGTGTTGCCCTAGACTTAATCC
>probe:Drosophila_2:1622996_at:193:489; Interrogation_Position=2412; Antisense; GTACAAAGTCCTGTTTAGTTCTAGA
>probe:Drosophila_2:1622996_at:598:215; Interrogation_Position=2508; Antisense; AAGATCGTAGCCACTTTCAGCGAGT
>probe:Drosophila_2:1622996_at:291:263; Interrogation_Position=2525; Antisense; CAGCGAGTCATCGTTGGCAGTCCAA
>probe:Drosophila_2:1622996_at:122:37; Interrogation_Position=2565; Antisense; ATCTCGCTGGCCGAAGCATTAAACT
>probe:Drosophila_2:1622996_at:380:21; Interrogation_Position=2607; Antisense; ATATTGACCTTTTGCACGTTGGAGG
>probe:Drosophila_2:1622996_at:311:409; Interrogation_Position=2732; Antisense; GACGTAGCGGATCTAATGGGCACTA
>probe:Drosophila_2:1622996_at:672:71; Interrogation_Position=2805; Antisense; AGGCAGCCACAAAAACCAGTTCATG
>probe:Drosophila_2:1622996_at:19:47; Interrogation_Position=2827; Antisense; ATGCTTATTAAATACGCCCCTCGAC
>probe:Drosophila_2:1622996_at:628:299; Interrogation_Position=2844; Antisense; CCCTCGACGTTCATGTTATCGGATG
>probe:Drosophila_2:1622996_at:448:203; Interrogation_Position=2880; Antisense; AACCATTGTCTAACATTGTCCGCTG
>probe:Drosophila_2:1622996_at:490:503; Interrogation_Position=2897; Antisense; GTCCGCTGCGTGTACATATATATCC
>probe:Drosophila_2:1622996_at:431:687; Interrogation_Position=2915; Antisense; TATATCCGTTTCGATCACAAGCCAC
>probe:Drosophila_2:1622996_at:493:645; Interrogation_Position=2950; Antisense; TCTTGCCGGCAATCGGAGCTGCAAA

Paste this into a BLAST search page for me
ATTGGTGTTGCCCTAGACTTAATCCGTACAAAGTCCTGTTTAGTTCTAGAAAGATCGTAGCCACTTTCAGCGAGTCAGCGAGTCATCGTTGGCAGTCCAAATCTCGCTGGCCGAAGCATTAAACTATATTGACCTTTTGCACGTTGGAGGGACGTAGCGGATCTAATGGGCACTAAGGCAGCCACAAAAACCAGTTCATGATGCTTATTAAATACGCCCCTCGACCCCTCGACGTTCATGTTATCGGATGAACCATTGTCTAACATTGTCCGCTGGTCCGCTGCGTGTACATATATATCCTATATCCGTTTCGATCACAAGCCACTCTTGCCGGCAATCGGAGCTGCAAA

Full Affymetrix probeset data:

Annotations for 1622996_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720