FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622997_at:

>probe:Drosophila_2:1622997_at:556:263; Interrogation_Position=210; Antisense; CAGCAGTTCCGGCAAGGTGGTCACC
>probe:Drosophila_2:1622997_at:438:647; Interrogation_Position=241; Antisense; TCACCACATAATCACAATCCGGCGA
>probe:Drosophila_2:1622997_at:10:685; Interrogation_Position=266; Antisense; TATCGCGCTCGGCTATCAAACAGTT
>probe:Drosophila_2:1622997_at:511:33; Interrogation_Position=280; Antisense; ATCAAACAGTTTTCCAGCACCGTGG
>probe:Drosophila_2:1622997_at:457:693; Interrogation_Position=327; Antisense; TTTCGATCCGGCCATTATTTCGGTG
>probe:Drosophila_2:1622997_at:316:689; Interrogation_Position=342; Antisense; TATTTCGGTGGCAGCTCATCAGTAC
>probe:Drosophila_2:1622997_at:259:117; Interrogation_Position=354; Antisense; AGCTCATCAGTACGCAGCTGCTATA
>probe:Drosophila_2:1622997_at:405:31; Interrogation_Position=376; Antisense; ATAACTAATGGAACCGTGCCGGCTG
>probe:Drosophila_2:1622997_at:264:507; Interrogation_Position=391; Antisense; GTGCCGGCTGGATTGTTTTCTGTGC
>probe:Drosophila_2:1622997_at:192:91; Interrogation_Position=419; Antisense; AGTACTCCATAAATCTGGCCGCCTT
>probe:Drosophila_2:1622997_at:582:357; Interrogation_Position=458; Antisense; GCAAGAGCTCTTCGATAGCCGATCT
>probe:Drosophila_2:1622997_at:78:319; Interrogation_Position=475; Antisense; GCCGATCTCCGGATGAAGGCCAAGA
>probe:Drosophila_2:1622997_at:317:107; Interrogation_Position=497; Antisense; AGAAGCACTCGGAATCGTTGGGTCT
>probe:Drosophila_2:1622997_at:579:585; Interrogation_Position=92; Antisense; TGGAACCATGTCGTGTGGCTCCCTA

Paste this into a BLAST search page for me
CAGCAGTTCCGGCAAGGTGGTCACCTCACCACATAATCACAATCCGGCGATATCGCGCTCGGCTATCAAACAGTTATCAAACAGTTTTCCAGCACCGTGGTTTCGATCCGGCCATTATTTCGGTGTATTTCGGTGGCAGCTCATCAGTACAGCTCATCAGTACGCAGCTGCTATAATAACTAATGGAACCGTGCCGGCTGGTGCCGGCTGGATTGTTTTCTGTGCAGTACTCCATAAATCTGGCCGCCTTGCAAGAGCTCTTCGATAGCCGATCTGCCGATCTCCGGATGAAGGCCAAGAAGAAGCACTCGGAATCGTTGGGTCTTGGAACCATGTCGTGTGGCTCCCTA

Full Affymetrix probeset data:

Annotations for 1622997_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720