FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622999_at:

>probe:Drosophila_2:1622999_at:172:627; Interrogation_Position=1456; Antisense; TGCCGCGTATGCAAATGCCTGCAAT
>probe:Drosophila_2:1622999_at:464:657; Interrogation_Position=1511; Antisense; TAAGGAACACCAACCATCAGCGAAC
>probe:Drosophila_2:1622999_at:183:123; Interrogation_Position=1529; Antisense; AGCGAACTCATATCACTTCTATCAA
>probe:Drosophila_2:1622999_at:200:5; Interrogation_Position=1621; Antisense; ATTGTAATACGCATCTAGGCTAAGC
>probe:Drosophila_2:1622999_at:70:3; Interrogation_Position=1637; Antisense; AGGCTAAGCGAATCCAATCCGATTT
>probe:Drosophila_2:1622999_at:231:725; Interrogation_Position=1683; Antisense; TTGTCTGTTTACCTTACCCTTATCT
>probe:Drosophila_2:1622999_at:360:705; Interrogation_Position=1696; Antisense; TTACCCTTATCTGTGTTGTCTCAAA
>probe:Drosophila_2:1622999_at:531:147; Interrogation_Position=1743; Antisense; ACTATATGTTGCGTGTCAGCCTGCC
>probe:Drosophila_2:1622999_at:214:321; Interrogation_Position=1813; Antisense; GCCCGATTCCTAAGCACGATCTGAT
>probe:Drosophila_2:1622999_at:1:31; Interrogation_Position=1841; Antisense; ATAAACAGTGATCCCTTCCTAGGCG
>probe:Drosophila_2:1622999_at:196:563; Interrogation_Position=1872; Antisense; GGAACCCATGGCCAGTTGCGGAAAC
>probe:Drosophila_2:1622999_at:208:559; Interrogation_Position=1891; Antisense; GGAAACTCGGTTTAGCAGGCTACTC
>probe:Drosophila_2:1622999_at:619:339; Interrogation_Position=1909; Antisense; GCTACTCGCTTAAAAGTGCACTCCT
>probe:Drosophila_2:1622999_at:199:221; Interrogation_Position=1922; Antisense; AAGTGCACTCCTTTAACGGATGAAA

Paste this into a BLAST search page for me
TGCCGCGTATGCAAATGCCTGCAATTAAGGAACACCAACCATCAGCGAACAGCGAACTCATATCACTTCTATCAAATTGTAATACGCATCTAGGCTAAGCAGGCTAAGCGAATCCAATCCGATTTTTGTCTGTTTACCTTACCCTTATCTTTACCCTTATCTGTGTTGTCTCAAAACTATATGTTGCGTGTCAGCCTGCCGCCCGATTCCTAAGCACGATCTGATATAAACAGTGATCCCTTCCTAGGCGGGAACCCATGGCCAGTTGCGGAAACGGAAACTCGGTTTAGCAGGCTACTCGCTACTCGCTTAAAAGTGCACTCCTAAGTGCACTCCTTTAACGGATGAAA

Full Affymetrix probeset data:

Annotations for 1622999_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720