Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623000_at:

>probe:Drosophila_2:1623000_at:385:73; Interrogation_Position=115; Antisense; AGGCACATTAACTCCTTAGTCGATG
>probe:Drosophila_2:1623000_at:230:79; Interrogation_Position=157; Antisense; AGGTTTATTCTTAAGGCTCTGGCAA
>probe:Drosophila_2:1623000_at:580:361; Interrogation_Position=178; Antisense; GCAATTTCATTGGATGCTCCACCTT
>probe:Drosophila_2:1623000_at:469:625; Interrogation_Position=195; Antisense; TCCACCTTCGTTCTTCACGGATAAA
>probe:Drosophila_2:1623000_at:377:177; Interrogation_Position=217; Antisense; AAACATTCGTTTATGCTGTCCGACG
>probe:Drosophila_2:1623000_at:472:285; Interrogation_Position=232; Antisense; CTGTCCGACGATCGCTTTAATCTGA
>probe:Drosophila_2:1623000_at:35:415; Interrogation_Position=255; Antisense; GACCACCCTACGGATGCTGTTTTAC
>probe:Drosophila_2:1623000_at:111:707; Interrogation_Position=276; Antisense; TTACCCGCCCGTGGAAGATCAGGAT
>probe:Drosophila_2:1623000_at:153:343; Interrogation_Position=311; Antisense; GCTTCATACGATGTGGAGCCCATGC
>probe:Drosophila_2:1623000_at:173:351; Interrogation_Position=344; Antisense; GCACCTTTACTCTGTTGGCTCAGGA
>probe:Drosophila_2:1623000_at:413:39; Interrogation_Position=428; Antisense; ATCTGCCAGGAGCACTCTTCATAAA
>probe:Drosophila_2:1623000_at:405:93; Interrogation_Position=485; Antisense; AGTTCTACCACGCTTTGCAACATAG
>probe:Drosophila_2:1623000_at:560:7; Interrogation_Position=559; Antisense; ATTGCCTATTTCTGTCATCCTGATA
>probe:Drosophila_2:1623000_at:291:497; Interrogation_Position=572; Antisense; GTCATCCTGATAACTCTGCACTGAT

Paste this into a BLAST search page for me
AGGCACATTAACTCCTTAGTCGATGAGGTTTATTCTTAAGGCTCTGGCAAGCAATTTCATTGGATGCTCCACCTTTCCACCTTCGTTCTTCACGGATAAAAAACATTCGTTTATGCTGTCCGACGCTGTCCGACGATCGCTTTAATCTGAGACCACCCTACGGATGCTGTTTTACTTACCCGCCCGTGGAAGATCAGGATGCTTCATACGATGTGGAGCCCATGCGCACCTTTACTCTGTTGGCTCAGGAATCTGCCAGGAGCACTCTTCATAAAAGTTCTACCACGCTTTGCAACATAGATTGCCTATTTCTGTCATCCTGATAGTCATCCTGATAACTCTGCACTGAT

Full Affymetrix probeset data:

Annotations for 1623000_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime