FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623002_at:

>probe:Drosophila_2:1623002_at:319:725; Interrogation_Position=319; Antisense; TTGGAAGCACTTTGGTGCCTGGGCT
>probe:Drosophila_2:1623002_at:369:617; Interrogation_Position=343; Antisense; TGCTTTCCGGGCAGGGCCTAAAAAT
>probe:Drosophila_2:1623002_at:423:521; Interrogation_Position=356; Antisense; GGGCCTAAAAATCCACAGCTGCAGA
>probe:Drosophila_2:1623002_at:28:157; Interrogation_Position=389; Antisense; AAACCCTTCTGTGCGGCCAATTACT
>probe:Drosophila_2:1623002_at:580:247; Interrogation_Position=406; Antisense; CAATTACTTGCCATGTGCCTTGAAA
>probe:Drosophila_2:1623002_at:79:359; Interrogation_Position=479; Antisense; GCAAAGCCCCGAAAGATCACCGAGA
>probe:Drosophila_2:1623002_at:324:109; Interrogation_Position=501; Antisense; AGAAGTATAATACGCCTGACCTACC
>probe:Drosophila_2:1623002_at:602:195; Interrogation_Position=627; Antisense; AACTGGAGGCGGATTTCTGGGCCCA
>probe:Drosophila_2:1623002_at:11:645; Interrogation_Position=681; Antisense; TCTTCGCAAAGATAACGCTCCGCAT
>probe:Drosophila_2:1623002_at:270:499; Interrogation_Position=709; Antisense; GTCTCTGGCCAAACCACGGGTATAT
>probe:Drosophila_2:1623002_at:434:145; Interrogation_Position=740; Antisense; ACTCCGCACTGCCTCATTAATAAAA
>probe:Drosophila_2:1623002_at:418:181; Interrogation_Position=761; Antisense; AAAAAAGTGTTGCATCCGCTGGATG
>probe:Drosophila_2:1623002_at:416:97; Interrogation_Position=837; Antisense; AGATCCGACTGTTGTACCTGTCCAA
>probe:Drosophila_2:1623002_at:75:597; Interrogation_Position=855; Antisense; TGTCCAAGCCGGTTTCTAGAAATGA

Paste this into a BLAST search page for me
TTGGAAGCACTTTGGTGCCTGGGCTTGCTTTCCGGGCAGGGCCTAAAAATGGGCCTAAAAATCCACAGCTGCAGAAAACCCTTCTGTGCGGCCAATTACTCAATTACTTGCCATGTGCCTTGAAAGCAAAGCCCCGAAAGATCACCGAGAAGAAGTATAATACGCCTGACCTACCAACTGGAGGCGGATTTCTGGGCCCATCTTCGCAAAGATAACGCTCCGCATGTCTCTGGCCAAACCACGGGTATATACTCCGCACTGCCTCATTAATAAAAAAAAAAGTGTTGCATCCGCTGGATGAGATCCGACTGTTGTACCTGTCCAATGTCCAAGCCGGTTTCTAGAAATGA

Full Affymetrix probeset data:

Annotations for 1623002_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720