Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623004_a_at:

>probe:Drosophila_2:1623004_a_at:700:387; Interrogation_Position=183; Antisense; GAAAATCTGGTGACGCGTCGCGGAA
>probe:Drosophila_2:1623004_a_at:639:709; Interrogation_Position=232; Antisense; TTCACTACAAACTCAACTCCAATCA
>probe:Drosophila_2:1623004_a_at:54:385; Interrogation_Position=274; Antisense; GAACTTGGCCACAATCACAGATGCA
>probe:Drosophila_2:1623004_a_at:21:239; Interrogation_Position=331; Antisense; AATACAGGCCAGGTCGTTGGACGGA
>probe:Drosophila_2:1623004_a_at:260:563; Interrogation_Position=380; Antisense; GGAAGCTGTCATCCCAAATGAGGAA
>probe:Drosophila_2:1623004_a_at:483:225; Interrogation_Position=420; Antisense; AAGGACTCGCGTTCACAGGAGGAGC
>probe:Drosophila_2:1623004_a_at:449:437; Interrogation_Position=438; Antisense; GAGGAGCGACCCCACATTCGTGAAC
>probe:Drosophila_2:1623004_a_at:558:25; Interrogation_Position=484; Antisense; ATAGGCGCCTCCAGAGGATCGCAAT
>probe:Drosophila_2:1623004_a_at:159:449; Interrogation_Position=500; Antisense; GATCGCAATGCCTGCTAAACAATTC
>probe:Drosophila_2:1623004_a_at:677:243; Interrogation_Position=520; Antisense; AATTCATCTCGCAGTTTATCTCCAC
>probe:Drosophila_2:1623004_a_at:495:225; Interrogation_Position=560; Antisense; AAGGCGTTACGTAGAAGCTGCATCA
>probe:Drosophila_2:1623004_a_at:89:329; Interrogation_Position=594; Antisense; GCGTTTGATGGATACTAGCTGATAC
>probe:Drosophila_2:1623004_a_at:7:31; Interrogation_Position=615; Antisense; ATACACGGCTTGTTTTCGCTATCAA
>probe:Drosophila_2:1623004_a_at:534:19; Interrogation_Position=666; Antisense; ATTTGCCTTTGCCTCATATGTTAGA

Paste this into a BLAST search page for me
GAAAATCTGGTGACGCGTCGCGGAATTCACTACAAACTCAACTCCAATCAGAACTTGGCCACAATCACAGATGCAAATACAGGCCAGGTCGTTGGACGGAGGAAGCTGTCATCCCAAATGAGGAAAAGGACTCGCGTTCACAGGAGGAGCGAGGAGCGACCCCACATTCGTGAACATAGGCGCCTCCAGAGGATCGCAATGATCGCAATGCCTGCTAAACAATTCAATTCATCTCGCAGTTTATCTCCACAAGGCGTTACGTAGAAGCTGCATCAGCGTTTGATGGATACTAGCTGATACATACACGGCTTGTTTTCGCTATCAAATTTGCCTTTGCCTCATATGTTAGA

Full Affymetrix probeset data:

Annotations for 1623004_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime