FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623006_at:

>probe:Drosophila_2:1623006_at:646:675; Interrogation_Position=2602; Antisense; TAGCTCTAGTCTTAGGCAGTCGCAC
>probe:Drosophila_2:1623006_at:399:25; Interrogation_Position=2631; Antisense; ATAGTTTAAGCCTCTGCTCGGTGCA
>probe:Drosophila_2:1623006_at:660:639; Interrogation_Position=2648; Antisense; TCGGTGCAGAGCAATCCCATGGCGA
>probe:Drosophila_2:1623006_at:13:75; Interrogation_Position=2697; Antisense; AGGACAATAACTGCTCGCTGCGACT
>probe:Drosophila_2:1623006_at:407:589; Interrogation_Position=2766; Antisense; TGGTCTAAGTGAGCCTCCAGTCTAC
>probe:Drosophila_2:1623006_at:419:165; Interrogation_Position=2804; Antisense; AAATCAGCCATTTTGCAGGACTCCC
>probe:Drosophila_2:1623006_at:307:73; Interrogation_Position=2820; Antisense; AGGACTCCCGTGCATAGTGCTACAA
>probe:Drosophila_2:1623006_at:593:451; Interrogation_Position=2877; Antisense; GATCTAGTTTCTGATTGCTTTGCAA
>probe:Drosophila_2:1623006_at:155:87; Interrogation_Position=2918; Antisense; AGTATTCTAGTTGTTGGGTCATCGA
>probe:Drosophila_2:1623006_at:287:493; Interrogation_Position=2976; Antisense; GTAAGCGTTAACTAGCTCAGCTGTA
>probe:Drosophila_2:1623006_at:296:25; Interrogation_Position=3050; Antisense; ATAGAGAACGCCCTGTACAATGCAT
>probe:Drosophila_2:1623006_at:357:231; Interrogation_Position=3068; Antisense; AATGCATTACTCAACCGTTTTTGTG
>probe:Drosophila_2:1623006_at:664:657; Interrogation_Position=3111; Antisense; TAAGTCAGCCATTTACGTTGCCTCT
>probe:Drosophila_2:1623006_at:360:627; Interrogation_Position=3129; Antisense; TGCCTCTCCAGCGAGTTTAGTTTGT

Paste this into a BLAST search page for me
TAGCTCTAGTCTTAGGCAGTCGCACATAGTTTAAGCCTCTGCTCGGTGCATCGGTGCAGAGCAATCCCATGGCGAAGGACAATAACTGCTCGCTGCGACTTGGTCTAAGTGAGCCTCCAGTCTACAAATCAGCCATTTTGCAGGACTCCCAGGACTCCCGTGCATAGTGCTACAAGATCTAGTTTCTGATTGCTTTGCAAAGTATTCTAGTTGTTGGGTCATCGAGTAAGCGTTAACTAGCTCAGCTGTAATAGAGAACGCCCTGTACAATGCATAATGCATTACTCAACCGTTTTTGTGTAAGTCAGCCATTTACGTTGCCTCTTGCCTCTCCAGCGAGTTTAGTTTGT

Full Affymetrix probeset data:

Annotations for 1623006_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720