FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623008_at:

>probe:Drosophila_2:1623008_at:16:595; Interrogation_Position=323; Antisense; TGGGAATGCCGGTCGGTACATTTTC
>probe:Drosophila_2:1623008_at:334:667; Interrogation_Position=339; Antisense; TACATTTTCCCAACACATCGTCAAG
>probe:Drosophila_2:1623008_at:186:451; Interrogation_Position=364; Antisense; GATCTAAAACTTCCGTTGTCACCTG
>probe:Drosophila_2:1623008_at:233:649; Interrogation_Position=458; Antisense; TCAGGGATCTGATTCTCCACTTGCA
>probe:Drosophila_2:1623008_at:544:715; Interrogation_Position=499; Antisense; TTCTGCATAGCCACAAGTTCGTTTA
>probe:Drosophila_2:1623008_at:194:77; Interrogation_Position=557; Antisense; AGGATATATTCCTGGCCTTTCACCA
>probe:Drosophila_2:1623008_at:720:465; Interrogation_Position=583; Antisense; GTTGTCTGTGGCGATGATCCGGCAC
>probe:Drosophila_2:1623008_at:342:515; Interrogation_Position=690; Antisense; GTGTCTTATATTCGAGGATGCTCCA
>probe:Drosophila_2:1623008_at:353:77; Interrogation_Position=704; Antisense; AGGATGCTCCAGTGGGCCTCATAGG
>probe:Drosophila_2:1623008_at:494:121; Interrogation_Position=738; Antisense; AGCGGGATCCCAAGTCATCTTTATT
>probe:Drosophila_2:1623008_at:386:221; Interrogation_Position=793; Antisense; AAGGGCGCCACCATGGTTCTAAAAT
>probe:Drosophila_2:1623008_at:333:659; Interrogation_Position=831; Antisense; TAAGCCTGAGCTCTTTGGTCTACCA
>probe:Drosophila_2:1623008_at:345:683; Interrogation_Position=859; Antisense; TTTGACACCTGCTCCAAATTCGAGT
>probe:Drosophila_2:1623008_at:6:163; Interrogation_Position=874; Antisense; AAATTCGAGTTTGGCTAATCCCTAG

Paste this into a BLAST search page for me
TGGGAATGCCGGTCGGTACATTTTCTACATTTTCCCAACACATCGTCAAGGATCTAAAACTTCCGTTGTCACCTGTCAGGGATCTGATTCTCCACTTGCATTCTGCATAGCCACAAGTTCGTTTAAGGATATATTCCTGGCCTTTCACCAGTTGTCTGTGGCGATGATCCGGCACGTGTCTTATATTCGAGGATGCTCCAAGGATGCTCCAGTGGGCCTCATAGGAGCGGGATCCCAAGTCATCTTTATTAAGGGCGCCACCATGGTTCTAAAATTAAGCCTGAGCTCTTTGGTCTACCATTTGACACCTGCTCCAAATTCGAGTAAATTCGAGTTTGGCTAATCCCTAG

Full Affymetrix probeset data:

Annotations for 1623008_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720