FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623009_at:

>probe:Drosophila_2:1623009_at:439:545; Interrogation_Position=1004; Antisense; GGAGGCGACTTCACCAACAACAATG
>probe:Drosophila_2:1623009_at:154:187; Interrogation_Position=1019; Antisense; AACAACAATGGCACCGGCGGCAAGT
>probe:Drosophila_2:1623009_at:89:561; Interrogation_Position=1100; Antisense; GGAACTCTTTCAATGGCCAACTCGG
>probe:Drosophila_2:1623009_at:209:573; Interrogation_Position=1139; Antisense; GGCTCGCAGTTTTTTATATGTACCA
>probe:Drosophila_2:1623009_at:345:159; Interrogation_Position=1185; Antisense; ACAAGCACGTCGTTTTTGGCCATGT
>probe:Drosophila_2:1623009_at:512:229; Interrogation_Position=1241; Antisense; GAACGTTGTGGCTCCAAGTCGGGCA
>probe:Drosophila_2:1623009_at:77:355; Interrogation_Position=1263; Antisense; GCACTCCCAGCCAAAAGATTGTCAT
>probe:Drosophila_2:1623009_at:530:95; Interrogation_Position=1278; Antisense; AGATTGTCATATACTCCTGTGGAGA
>probe:Drosophila_2:1623009_at:507:389; Interrogation_Position=814; Antisense; GAAACGCAATCCACAAGTCTTCTTT
>probe:Drosophila_2:1623009_at:57:233; Interrogation_Position=857; Antisense; AATGACGCCGGTCGCATTGTGATGC
>probe:Drosophila_2:1623009_at:570:103; Interrogation_Position=906; Antisense; AGACGGCGGAGAACTTTCGGCAATT
>probe:Drosophila_2:1623009_at:565:247; Interrogation_Position=927; Antisense; AATTGTGCACCCACGAGCAGGGCTA
>probe:Drosophila_2:1623009_at:674:81; Interrogation_Position=945; Antisense; AGGGCTACGGCTACAAAGGCTGCTC
>probe:Drosophila_2:1623009_at:322:329; Interrogation_Position=978; Antisense; GCGTGATACCCGAGTTTATGTGTCA

Paste this into a BLAST search page for me
GGAGGCGACTTCACCAACAACAATGAACAACAATGGCACCGGCGGCAAGTGGAACTCTTTCAATGGCCAACTCGGGGCTCGCAGTTTTTTATATGTACCAACAAGCACGTCGTTTTTGGCCATGTGAACGTTGTGGCTCCAAGTCGGGCAGCACTCCCAGCCAAAAGATTGTCATAGATTGTCATATACTCCTGTGGAGAGAAACGCAATCCACAAGTCTTCTTTAATGACGCCGGTCGCATTGTGATGCAGACGGCGGAGAACTTTCGGCAATTAATTGTGCACCCACGAGCAGGGCTAAGGGCTACGGCTACAAAGGCTGCTCGCGTGATACCCGAGTTTATGTGTCA

Full Affymetrix probeset data:

Annotations for 1623009_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720