FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623010_at:

>probe:Drosophila_2:1623010_at:608:403; Interrogation_Position=1002; Antisense; GACTTTGAAGTTCCTCATCATGCGC
>probe:Drosophila_2:1623010_at:78:175; Interrogation_Position=1032; Antisense; AAAGCCCTTGGCGATTCTGGTGGGT
>probe:Drosophila_2:1623010_at:174:531; Interrogation_Position=1053; Antisense; GGGTGGCACATATCCCATGAACTTG
>probe:Drosophila_2:1623010_at:631:677; Interrogation_Position=599; Antisense; TAGTGACATTTACCCTTTTCGCCAT
>probe:Drosophila_2:1623010_at:652:633; Interrogation_Position=617; Antisense; TCGCCATTCTCATGTGTCGAGTGTT
>probe:Drosophila_2:1623010_at:412:231; Interrogation_Position=747; Antisense; AATGAATGCCTTGAACACCCATCTT
>probe:Drosophila_2:1623010_at:135:517; Interrogation_Position=778; Antisense; GTGGAGTTCCTTTGCTTTGGTGCCA
>probe:Drosophila_2:1623010_at:187:693; Interrogation_Position=793; Antisense; TTTGGTGCCATGCTATGTGTTCTTC
>probe:Drosophila_2:1623010_at:669:61; Interrogation_Position=807; Antisense; ATGTGTTCTTCTTTTCTCCTTAATA
>probe:Drosophila_2:1623010_at:207:181; Interrogation_Position=839; Antisense; AAACAATTGCTCAGACCGTCATAGT
>probe:Drosophila_2:1623010_at:392:413; Interrogation_Position=852; Antisense; GACCGTCATAGTCATCGCATACATG
>probe:Drosophila_2:1623010_at:12:19; Interrogation_Position=885; Antisense; ATTTGCCAACAGTGTAGTCCTTTAC
>probe:Drosophila_2:1623010_at:253:85; Interrogation_Position=900; Antisense; AGTCCTTTACTACGTGGCCAATGAG
>probe:Drosophila_2:1623010_at:538:689; Interrogation_Position=945; Antisense; TATTGCCATTGCTGCCTATGAGAGC

Paste this into a BLAST search page for me
GACTTTGAAGTTCCTCATCATGCGCAAAGCCCTTGGCGATTCTGGTGGGTGGGTGGCACATATCCCATGAACTTGTAGTGACATTTACCCTTTTCGCCATTCGCCATTCTCATGTGTCGAGTGTTAATGAATGCCTTGAACACCCATCTTGTGGAGTTCCTTTGCTTTGGTGCCATTTGGTGCCATGCTATGTGTTCTTCATGTGTTCTTCTTTTCTCCTTAATAAAACAATTGCTCAGACCGTCATAGTGACCGTCATAGTCATCGCATACATGATTTGCCAACAGTGTAGTCCTTTACAGTCCTTTACTACGTGGCCAATGAGTATTGCCATTGCTGCCTATGAGAGC

Full Affymetrix probeset data:

Annotations for 1623010_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720