FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623012_at:

>probe:Drosophila_2:1623012_at:104:115; Interrogation_Position=123; Antisense; AGCAGATACGCTGCATCTCATCGGC
>probe:Drosophila_2:1623012_at:379:137; Interrogation_Position=149; Antisense; ACGACGGCGGTTACCAGGCTGCATC
>probe:Drosophila_2:1623012_at:346:45; Interrogation_Position=171; Antisense; ATCGCTCGGTTTACTGCCGGCTATA
>probe:Drosophila_2:1623012_at:201:627; Interrogation_Position=185; Antisense; TGCCGGCTATATCCCACAGTTGTGG
>probe:Drosophila_2:1623012_at:294:533; Interrogation_Position=208; Antisense; GGTGCAACCCGATGGATCCACGATA
>probe:Drosophila_2:1623012_at:333:49; Interrogation_Position=223; Antisense; ATCCACGATAAACATCCGCTATCAC
>probe:Drosophila_2:1623012_at:278:627; Interrogation_Position=23; Antisense; TGCCTGGCAGCAAAAACACGATTTA
>probe:Drosophila_2:1623012_at:88:633; Interrogation_Position=237; Antisense; TCCGCTATCACGAGCCCAGGAAGAT
>probe:Drosophila_2:1623012_at:345:461; Interrogation_Position=259; Antisense; GATTATCAAGCTTCCCTTGGATCTG
>probe:Drosophila_2:1623012_at:568:725; Interrogation_Position=275; Antisense; TTGGATCTGAGCACCTTAACCGATG
>probe:Drosophila_2:1623012_at:709:359; Interrogation_Position=327; Antisense; GCAAGCCGCGCAAGAAGGTCAAGAT
>probe:Drosophila_2:1623012_at:593:519; Interrogation_Position=362; Antisense; GTGGAGGACAACTTCAACGCCAAGA
>probe:Drosophila_2:1623012_at:569:373; Interrogation_Position=409; Antisense; GAAGTAGCCGCATTTTATTCACTAT
>probe:Drosophila_2:1623012_at:481:467; Interrogation_Position=94; Antisense; GTTGCTGAAACAGTTGCCCCAGGCT

Paste this into a BLAST search page for me
AGCAGATACGCTGCATCTCATCGGCACGACGGCGGTTACCAGGCTGCATCATCGCTCGGTTTACTGCCGGCTATATGCCGGCTATATCCCACAGTTGTGGGGTGCAACCCGATGGATCCACGATAATCCACGATAAACATCCGCTATCACTGCCTGGCAGCAAAAACACGATTTATCCGCTATCACGAGCCCAGGAAGATGATTATCAAGCTTCCCTTGGATCTGTTGGATCTGAGCACCTTAACCGATGGCAAGCCGCGCAAGAAGGTCAAGATGTGGAGGACAACTTCAACGCCAAGAGAAGTAGCCGCATTTTATTCACTATGTTGCTGAAACAGTTGCCCCAGGCT

Full Affymetrix probeset data:

Annotations for 1623012_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720