FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623014_at:

>probe:Drosophila_2:1623014_at:280:603; Interrogation_Position=107; Antisense; TGATATTAACCACCTCTTCGGACGA
>probe:Drosophila_2:1623014_at:259:87; Interrogation_Position=149; Antisense; AGTCCAGTATTGTTCGCTTAGGGCG
>probe:Drosophila_2:1623014_at:357:9; Interrogation_Position=17; Antisense; ATTCCGGCTATTCGTCAGTCTTAAT
>probe:Drosophila_2:1623014_at:626:561; Interrogation_Position=206; Antisense; GGAACTATGACACCACTGAGGAGAC
>probe:Drosophila_2:1623014_at:558:439; Interrogation_Position=238; Antisense; GAGGCTGTTGTATACCGCAGCAATT
>probe:Drosophila_2:1623014_at:562:725; Interrogation_Position=294; Antisense; TTGGGCCATTCCTAAGCAAACCTTT
>probe:Drosophila_2:1623014_at:225:285; Interrogation_Position=372; Antisense; CTGTTCCAATGTGCCGCAGTTCAAG
>probe:Drosophila_2:1623014_at:42:243; Interrogation_Position=39; Antisense; AATATTGTTGGCAGTTTGGCTAATC
>probe:Drosophila_2:1623014_at:170:301; Interrogation_Position=410; Antisense; CGCCTTGGCCGAAACGAACGTATAT
>probe:Drosophila_2:1623014_at:239:591; Interrogation_Position=445; Antisense; TGCGTCTTTGAAGCCGAAGGTTTTC
>probe:Drosophila_2:1623014_at:237:369; Interrogation_Position=460; Antisense; GAAGGTTTTCCGGATATCGTGCCAC
>probe:Drosophila_2:1623014_at:710:505; Interrogation_Position=478; Antisense; GTGCCACCTGGATTCTACAAGATTA
>probe:Drosophila_2:1623014_at:244:249; Interrogation_Position=508; Antisense; AATTGTACCGGACCTGATCAGCCAT
>probe:Drosophila_2:1623014_at:415:313; Interrogation_Position=528; Antisense; GCCATCGTGGAGCTTTATCGGAATT

Paste this into a BLAST search page for me
TGATATTAACCACCTCTTCGGACGAAGTCCAGTATTGTTCGCTTAGGGCGATTCCGGCTATTCGTCAGTCTTAATGGAACTATGACACCACTGAGGAGACGAGGCTGTTGTATACCGCAGCAATTTTGGGCCATTCCTAAGCAAACCTTTCTGTTCCAATGTGCCGCAGTTCAAGAATATTGTTGGCAGTTTGGCTAATCCGCCTTGGCCGAAACGAACGTATATTGCGTCTTTGAAGCCGAAGGTTTTCGAAGGTTTTCCGGATATCGTGCCACGTGCCACCTGGATTCTACAAGATTAAATTGTACCGGACCTGATCAGCCATGCCATCGTGGAGCTTTATCGGAATT

Full Affymetrix probeset data:

Annotations for 1623014_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720