Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623016_at:

>probe:Drosophila_2:1623016_at:261:395; Interrogation_Position=1384; Antisense; GAAATCTTACGTGGGCTACATGCCG
>probe:Drosophila_2:1623016_at:81:607; Interrogation_Position=1444; Antisense; TGAGTCCGCCCAGGTGCTCAATGAG
>probe:Drosophila_2:1623016_at:345:609; Interrogation_Position=1465; Antisense; TGAGCTTCAGATACCCATCTACGAT
>probe:Drosophila_2:1623016_at:277:379; Interrogation_Position=1522; Antisense; GAAGCGCTACTTCTCAGCGGATCAG
>probe:Drosophila_2:1623016_at:679:543; Interrogation_Position=1540; Antisense; GGATCAGTTCGACAAGGCCGTACTC
>probe:Drosophila_2:1623016_at:69:433; Interrogation_Position=1572; Antisense; GAGTCCTGTCCGGTGGCAAGGATAC
>probe:Drosophila_2:1623016_at:385:533; Interrogation_Position=1613; Antisense; GGTGGTCCGTTAATGCTGCCAGAAC
>probe:Drosophila_2:1623016_at:297:481; Interrogation_Position=1639; Antisense; GTATCAGGGCCAACTACGGTTCTAT
>probe:Drosophila_2:1623016_at:694:713; Interrogation_Position=1658; Antisense; TTCTATCTGATTGGCGTGGTGTCCT
>probe:Drosophila_2:1623016_at:464:515; Interrogation_Position=1676; Antisense; GTGTCCTACGGAATTGGTTGTGCCC
>probe:Drosophila_2:1623016_at:404:729; Interrogation_Position=1693; Antisense; TTGTGCCCGACCAAATGTGCCTGGA
>probe:Drosophila_2:1623016_at:421:549; Interrogation_Position=1715; Antisense; GGAGTTTACTCCAGCACACAGTACT
>probe:Drosophila_2:1623016_at:491:545; Interrogation_Position=1749; Antisense; GGATCATCCAACAGGTCCAGGACAC
>probe:Drosophila_2:1623016_at:37:617; Interrogation_Position=1800; Antisense; TGCACCTAGCTCATAAGATCCCTAA

Paste this into a BLAST search page for me
GAAATCTTACGTGGGCTACATGCCGTGAGTCCGCCCAGGTGCTCAATGAGTGAGCTTCAGATACCCATCTACGATGAAGCGCTACTTCTCAGCGGATCAGGGATCAGTTCGACAAGGCCGTACTCGAGTCCTGTCCGGTGGCAAGGATACGGTGGTCCGTTAATGCTGCCAGAACGTATCAGGGCCAACTACGGTTCTATTTCTATCTGATTGGCGTGGTGTCCTGTGTCCTACGGAATTGGTTGTGCCCTTGTGCCCGACCAAATGTGCCTGGAGGAGTTTACTCCAGCACACAGTACTGGATCATCCAACAGGTCCAGGACACTGCACCTAGCTCATAAGATCCCTAA

Full Affymetrix probeset data:

Annotations for 1623016_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime