FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623017_at:

>probe:Drosophila_2:1623017_at:423:185; Interrogation_Position=1899; Antisense; AACACTAAACCGATACTCGCCATAC
>probe:Drosophila_2:1623017_at:672:313; Interrogation_Position=1917; Antisense; GCCATACGCGGTTTCTAATGTGGTA
>probe:Drosophila_2:1623017_at:177:1; Interrogation_Position=2041; Antisense; CGTCGGATACGTTTTTAACCAGCAT
>probe:Drosophila_2:1623017_at:355:687; Interrogation_Position=2071; Antisense; TATACATATACATAGCAGCGCTGCT
>probe:Drosophila_2:1623017_at:335:123; Interrogation_Position=2087; Antisense; AGCGCTGCTAACTGCATGATCCGAT
>probe:Drosophila_2:1623017_at:638:449; Interrogation_Position=2104; Antisense; GATCCGATAAGTATTATGTGCCTGA
>probe:Drosophila_2:1623017_at:138:61; Interrogation_Position=2119; Antisense; ATGTGCCTGAAGACAGCTACTGAAT
>probe:Drosophila_2:1623017_at:82:357; Interrogation_Position=2166; Antisense; GCAAAGGCTATGTTCACTGTACCGC
>probe:Drosophila_2:1623017_at:302:487; Interrogation_Position=2184; Antisense; GTACCGCCCATCGTATTGTAATTTT
>probe:Drosophila_2:1623017_at:641:135; Interrogation_Position=2218; Antisense; ACGAAACAGACTGTCGCCGCTGAGG
>probe:Drosophila_2:1623017_at:726:597; Interrogation_Position=2259; Antisense; TGTTGAGGACGCCAAACCTACGGAA
>probe:Drosophila_2:1623017_at:545:373; Interrogation_Position=2290; Antisense; GAAGAAGTCTAGCTATGGCCGCTTC
>probe:Drosophila_2:1623017_at:650:577; Interrogation_Position=2306; Antisense; GGCCGCTTCTTTTGCAATTGTGTTG
>probe:Drosophila_2:1623017_at:365:453; Interrogation_Position=2456; Antisense; GATCTCAGATCGTATTTGCTAGGTA

Paste this into a BLAST search page for me
AACACTAAACCGATACTCGCCATACGCCATACGCGGTTTCTAATGTGGTACGTCGGATACGTTTTTAACCAGCATTATACATATACATAGCAGCGCTGCTAGCGCTGCTAACTGCATGATCCGATGATCCGATAAGTATTATGTGCCTGAATGTGCCTGAAGACAGCTACTGAATGCAAAGGCTATGTTCACTGTACCGCGTACCGCCCATCGTATTGTAATTTTACGAAACAGACTGTCGCCGCTGAGGTGTTGAGGACGCCAAACCTACGGAAGAAGAAGTCTAGCTATGGCCGCTTCGGCCGCTTCTTTTGCAATTGTGTTGGATCTCAGATCGTATTTGCTAGGTA

Full Affymetrix probeset data:

Annotations for 1623017_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720