FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623018_at:

>probe:Drosophila_2:1623018_at:55:543; Interrogation_Position=109; Antisense; GGATTCCACGGCAGACTAAACGAAC
>probe:Drosophila_2:1623018_at:583:61; Interrogation_Position=13; Antisense; ATGTCCGGTTATCAAGTCCCACTAG
>probe:Drosophila_2:1623018_at:138:645; Interrogation_Position=144; Antisense; TCTTGGGAATCAGACATGGGCGGCT
>probe:Drosophila_2:1623018_at:472:269; Interrogation_Position=158; Antisense; CATGGGCGGCTGATATCATTGGGAA
>probe:Drosophila_2:1623018_at:57:99; Interrogation_Position=189; Antisense; AGATGGCCGATGGACGTACACCAAT
>probe:Drosophila_2:1623018_at:637:553; Interrogation_Position=200; Antisense; GGACGTACACCAATCGGGATGTGGA
>probe:Drosophila_2:1623018_at:61:407; Interrogation_Position=232; Antisense; GACGGAGACGTACTTTACTACTGGA
>probe:Drosophila_2:1623018_at:161:709; Interrogation_Position=246; Antisense; TTACTACTGGACAACAGTGCGGTAT
>probe:Drosophila_2:1623018_at:610:537; Interrogation_Position=266; Antisense; GGTATAATGGCCGAGACTATCACCG
>probe:Drosophila_2:1623018_at:725:103; Interrogation_Position=279; Antisense; AGACTATCACCGGATGAACCAGAGT
>probe:Drosophila_2:1623018_at:437:443; Interrogation_Position=291; Antisense; GATGAACCAGAGTGCCGGCTTCTAA
>probe:Drosophila_2:1623018_at:499:147; Interrogation_Position=33; Antisense; ACTAGCCCGAGTAACTTCTTCAGAA
>probe:Drosophila_2:1623018_at:188:607; Interrogation_Position=84; Antisense; TGATGAGCCGGGAATTTCACTGTTC
>probe:Drosophila_2:1623018_at:346:243; Interrogation_Position=96; Antisense; AATTTCACTGTTCGGATTCCACGGC

Paste this into a BLAST search page for me
GGATTCCACGGCAGACTAAACGAACATGTCCGGTTATCAAGTCCCACTAGTCTTGGGAATCAGACATGGGCGGCTCATGGGCGGCTGATATCATTGGGAAAGATGGCCGATGGACGTACACCAATGGACGTACACCAATCGGGATGTGGAGACGGAGACGTACTTTACTACTGGATTACTACTGGACAACAGTGCGGTATGGTATAATGGCCGAGACTATCACCGAGACTATCACCGGATGAACCAGAGTGATGAACCAGAGTGCCGGCTTCTAAACTAGCCCGAGTAACTTCTTCAGAATGATGAGCCGGGAATTTCACTGTTCAATTTCACTGTTCGGATTCCACGGC

Full Affymetrix probeset data:

Annotations for 1623018_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720