FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623020_at:

>probe:Drosophila_2:1623020_at:348:195; Interrogation_Position=1009; Antisense; AACTGTGAGAACAACCCCGGTGTGC
>probe:Drosophila_2:1623020_at:452:177; Interrogation_Position=1059; Antisense; AAACGGCTCTCAGTCATCTTTTATA
>probe:Drosophila_2:1623020_at:30:591; Interrogation_Position=562; Antisense; TGGTGCGCTATTTCGTGGAGCAGAA
>probe:Drosophila_2:1623020_at:612:537; Interrogation_Position=591; Antisense; GGTAGAGGACACATCGCTGCCACCT
>probe:Drosophila_2:1623020_at:575:569; Interrogation_Position=627; Antisense; GGCTTCAGTCCAGTGCCATTTTCAC
>probe:Drosophila_2:1623020_at:217:307; Interrogation_Position=685; Antisense; CCTACTTGCTCTCCCTGAAAGTGGA
>probe:Drosophila_2:1623020_at:612:27; Interrogation_Position=750; Antisense; ATAGCCACCGATTTCCTGCAGGAGG
>probe:Drosophila_2:1623020_at:730:313; Interrogation_Position=774; Antisense; GCCTTCACTGGCTCGCAGGGCGGAA
>probe:Drosophila_2:1623020_at:202:79; Interrogation_Position=799; Antisense; AGGTGGGTCTGAGTACGGCCAATCA
>probe:Drosophila_2:1623020_at:352:239; Interrogation_Position=819; Antisense; AATCAGAAACGGATGACGGCCCAGA
>probe:Drosophila_2:1623020_at:559:611; Interrogation_Position=832; Antisense; TGACGGCCCAGAGATGTGGCGATCT
>probe:Drosophila_2:1623020_at:651:717; Interrogation_Position=858; Antisense; TTCGCCGTTGCCTTGGCCAATAAGA
>probe:Drosophila_2:1623020_at:133:33; Interrogation_Position=877; Antisense; ATAAGATGGATCTCACCTGGTGCGG
>probe:Drosophila_2:1623020_at:657:95; Interrogation_Position=955; Antisense; AGATTCTGGCTCAATTGATGACCGA

Paste this into a BLAST search page for me
AACTGTGAGAACAACCCCGGTGTGCAAACGGCTCTCAGTCATCTTTTATATGGTGCGCTATTTCGTGGAGCAGAAGGTAGAGGACACATCGCTGCCACCTGGCTTCAGTCCAGTGCCATTTTCACCCTACTTGCTCTCCCTGAAAGTGGAATAGCCACCGATTTCCTGCAGGAGGGCCTTCACTGGCTCGCAGGGCGGAAAGGTGGGTCTGAGTACGGCCAATCAAATCAGAAACGGATGACGGCCCAGATGACGGCCCAGAGATGTGGCGATCTTTCGCCGTTGCCTTGGCCAATAAGAATAAGATGGATCTCACCTGGTGCGGAGATTCTGGCTCAATTGATGACCGA

Full Affymetrix probeset data:

Annotations for 1623020_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720