FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623021_at:

>probe:Drosophila_2:1623021_at:441:103; Interrogation_Position=337; Antisense; AGACGGACATCCTTACTGTTCGCGA
>probe:Drosophila_2:1623021_at:95:451; Interrogation_Position=360; Antisense; GATCGCCTGATGTTCCGCAAGAATC
>probe:Drosophila_2:1623021_at:450:201; Interrogation_Position=402; Antisense; AACCGTGAAATGTGTCCCAAGCCCT
>probe:Drosophila_2:1623021_at:157:443; Interrogation_Position=437; Antisense; GATGTCCAGCTTTCTGTACGAGCAC
>probe:Drosophila_2:1623021_at:681:487; Interrogation_Position=473; Antisense; GTACTTCATTGAGCCGGTCGTTGCT
>probe:Drosophila_2:1623021_at:90:415; Interrogation_Position=512; Antisense; GACCATGGAGCCTTTTATCTGCAAC
>probe:Drosophila_2:1623021_at:494:67; Interrogation_Position=607; Antisense; ATGGCATGTGCGAAACCCTGTGGAA
>probe:Drosophila_2:1623021_at:18:121; Interrogation_Position=652; Antisense; AGCTGTTTGAGGTCATCGCCCAGTC
>probe:Drosophila_2:1623021_at:470:301; Interrogation_Position=670; Antisense; CCCAGTCCATTGTGAACGCATTCGA
>probe:Drosophila_2:1623021_at:119:507; Interrogation_Position=718; Antisense; GTGCCACCGTCTACATTATCGAGAA
>probe:Drosophila_2:1623021_at:535:395; Interrogation_Position=744; Antisense; GACAAGATCACGGAGCGCACACTGA
>probe:Drosophila_2:1623021_at:450:613; Interrogation_Position=766; Antisense; TGAAGACCCGCATGGACTAGATGAT
>probe:Drosophila_2:1623021_at:301:433; Interrogation_Position=795; Antisense; GAGGTTCCCTTGGTGATTTTGTATA
>probe:Drosophila_2:1623021_at:286:269; Interrogation_Position=864; Antisense; CATGTGCGTATTTCTTTTCCGTATA

Paste this into a BLAST search page for me
AGACGGACATCCTTACTGTTCGCGAGATCGCCTGATGTTCCGCAAGAATCAACCGTGAAATGTGTCCCAAGCCCTGATGTCCAGCTTTCTGTACGAGCACGTACTTCATTGAGCCGGTCGTTGCTGACCATGGAGCCTTTTATCTGCAACATGGCATGTGCGAAACCCTGTGGAAAGCTGTTTGAGGTCATCGCCCAGTCCCCAGTCCATTGTGAACGCATTCGAGTGCCACCGTCTACATTATCGAGAAGACAAGATCACGGAGCGCACACTGATGAAGACCCGCATGGACTAGATGATGAGGTTCCCTTGGTGATTTTGTATACATGTGCGTATTTCTTTTCCGTATA

Full Affymetrix probeset data:

Annotations for 1623021_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720