FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623022_at:

>probe:Drosophila_2:1623022_at:582:549; Interrogation_Position=1024; Antisense; GGAGGGCGGCAAGCATCATGTCCAC
>probe:Drosophila_2:1623022_at:175:21; Interrogation_Position=1077; Antisense; ATATCGTTCCCTTCATCCGAAATCA
>probe:Drosophila_2:1623022_at:628:395; Interrogation_Position=1095; Antisense; GAAATCACAGACCTCCAAGAAGCAG
>probe:Drosophila_2:1623022_at:535:67; Interrogation_Position=551; Antisense; ATGGCACCAAGCACAGTCGATATGA
>probe:Drosophila_2:1623022_at:32:647; Interrogation_Position=581; Antisense; TCATTGGATGTACTGCTGCCGCGGA
>probe:Drosophila_2:1623022_at:131:145; Interrogation_Position=592; Antisense; ACTGCTGCCGCGGAGAATCGAGGAT
>probe:Drosophila_2:1623022_at:635:635; Interrogation_Position=609; Antisense; TCGAGGATCCCAGCAAGTTGACCAA
>probe:Drosophila_2:1623022_at:306:315; Interrogation_Position=694; Antisense; GCCATCGTTCACCTTGAGTAAGCTG
>probe:Drosophila_2:1623022_at:115:105; Interrogation_Position=723; Antisense; AGACGCTCGCCAGGAACAGCAACAA
>probe:Drosophila_2:1623022_at:329:577; Interrogation_Position=793; Antisense; GGCCAAATCAAACATGTACCCGGAA
>probe:Drosophila_2:1623022_at:244:559; Interrogation_Position=814; Antisense; GGAAAAGGTATTCTTCTCCAGAGAT
>probe:Drosophila_2:1623022_at:274:197; Interrogation_Position=875; Antisense; AACGGACTTGCTCTTGAAATGGCGA
>probe:Drosophila_2:1623022_at:192:657; Interrogation_Position=931; Antisense; TAAGGGATCCCTTTCACCATTTGTG
>probe:Drosophila_2:1623022_at:15:129; Interrogation_Position=946; Antisense; ACCATTTGTGGGACCTCGATGCAAC

Paste this into a BLAST search page for me
GGAGGGCGGCAAGCATCATGTCCACATATCGTTCCCTTCATCCGAAATCAGAAATCACAGACCTCCAAGAAGCAGATGGCACCAAGCACAGTCGATATGATCATTGGATGTACTGCTGCCGCGGAACTGCTGCCGCGGAGAATCGAGGATTCGAGGATCCCAGCAAGTTGACCAAGCCATCGTTCACCTTGAGTAAGCTGAGACGCTCGCCAGGAACAGCAACAAGGCCAAATCAAACATGTACCCGGAAGGAAAAGGTATTCTTCTCCAGAGATAACGGACTTGCTCTTGAAATGGCGATAAGGGATCCCTTTCACCATTTGTGACCATTTGTGGGACCTCGATGCAAC

Full Affymetrix probeset data:

Annotations for 1623022_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720