Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623023_at:

>probe:Drosophila_2:1623023_at:626:43; Interrogation_Position=2283; Antisense; ATGCGTTACAACGAGGTTACCACGA
>probe:Drosophila_2:1623023_at:611:473; Interrogation_Position=2298; Antisense; GTTACCACGACGGAAGACGATACAA
>probe:Drosophila_2:1623023_at:706:391; Interrogation_Position=2365; Antisense; GAAAGCGGCATATCGAACGAGCTCG
>probe:Drosophila_2:1623023_at:597:375; Interrogation_Position=2393; Antisense; GAAGAGACATCATCAGACGCAGCAA
>probe:Drosophila_2:1623023_at:394:671; Interrogation_Position=2427; Antisense; TAGCCACAGTAACATTTTCCTTTTG
>probe:Drosophila_2:1623023_at:725:275; Interrogation_Position=2464; Antisense; CTTACATAGCTTTAACAACAGTCTT
>probe:Drosophila_2:1623023_at:438:259; Interrogation_Position=2494; Antisense; CACTAATTGGATTTACTGTCGAACA
>probe:Drosophila_2:1623023_at:618:465; Interrogation_Position=2528; Antisense; GATTGTTATGGTCGTCATCAAAACT
>probe:Drosophila_2:1623023_at:721:95; Interrogation_Position=2580; Antisense; AGATTTGTCATAATTCCACTTTAAA
>probe:Drosophila_2:1623023_at:186:39; Interrogation_Position=2613; Antisense; ATCTAACATTTTTTGGTGTGTCCAA
>probe:Drosophila_2:1623023_at:463:653; Interrogation_Position=2711; Antisense; TAATCCCTACAATGCGTATAGTCTT
>probe:Drosophila_2:1623023_at:198:483; Interrogation_Position=2726; Antisense; GTATAGTCTTCGTTGATGCTGCCAC
>probe:Drosophila_2:1623023_at:534:467; Interrogation_Position=2737; Antisense; GTTGATGCTGCCACGATTATTTACG
>probe:Drosophila_2:1623023_at:471:461; Interrogation_Position=2751; Antisense; GATTATTTACGGCATATTACACATG

Paste this into a BLAST search page for me
ATGCGTTACAACGAGGTTACCACGAGTTACCACGACGGAAGACGATACAAGAAAGCGGCATATCGAACGAGCTCGGAAGAGACATCATCAGACGCAGCAATAGCCACAGTAACATTTTCCTTTTGCTTACATAGCTTTAACAACAGTCTTCACTAATTGGATTTACTGTCGAACAGATTGTTATGGTCGTCATCAAAACTAGATTTGTCATAATTCCACTTTAAAATCTAACATTTTTTGGTGTGTCCAATAATCCCTACAATGCGTATAGTCTTGTATAGTCTTCGTTGATGCTGCCACGTTGATGCTGCCACGATTATTTACGGATTATTTACGGCATATTACACATG

Full Affymetrix probeset data:

Annotations for 1623023_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime