Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623027_s_at:

>probe:Drosophila_2:1623027_s_at:660:569; Interrogation_Position=1039; Antisense; GGCTCCCTTCGGCATGATTAACTAA
>probe:Drosophila_2:1623027_s_at:85:635; Interrogation_Position=495; Antisense; TCGCTGCCACCGGAAAGAAGGTTGC
>probe:Drosophila_2:1623027_s_at:428:309; Interrogation_Position=500; Antisense; GCCACCGGAAAGAAGGTTGCCAAGA
>probe:Drosophila_2:1623027_s_at:354:149; Interrogation_Position=531; Antisense; ACTTCCTGAAGGACAACCACGGTCT
>probe:Drosophila_2:1623027_s_at:728:303; Interrogation_Position=535; Antisense; CCTGAAGGACAACCACGGTCTGAAT
>probe:Drosophila_2:1623027_s_at:669:319; Interrogation_Position=596; Antisense; GCCCATGTGGCTGGATATGCCGGCA
>probe:Drosophila_2:1623027_s_at:322:543; Interrogation_Position=608; Antisense; GGATATGCCGGCAAGAACACCGACG
>probe:Drosophila_2:1623027_s_at:368:359; Interrogation_Position=618; Antisense; GCAAGAACACCGACGGCCAGGTGCA
>probe:Drosophila_2:1623027_s_at:667:159; Interrogation_Position=687; Antisense; ACAAGCCCAACAAGCGTCTGAATTC
>probe:Drosophila_2:1623027_s_at:327:125; Interrogation_Position=690; Antisense; AGCCCAACAAGCGTCTGAATTCCGA
>probe:Drosophila_2:1623027_s_at:487:613; Interrogation_Position=705; Antisense; TGAATTCCGACGATGCCTGGTATGT
>probe:Drosophila_2:1623027_s_at:709:245; Interrogation_Position=707; Antisense; AATTCCGACGATGCCTGGTATGTGG
>probe:Drosophila_2:1623027_s_at:696:285; Interrogation_Position=892; Antisense; CGAGGACAACTTCGGAACCATGAAG
>probe:Drosophila_2:1623027_s_at:632:379; Interrogation_Position=906; Antisense; GAACCATGAAGTGCGGAGACTACGA

Paste this into a BLAST search page for me
GGCTCCCTTCGGCATGATTAACTAATCGCTGCCACCGGAAAGAAGGTTGCGCCACCGGAAAGAAGGTTGCCAAGAACTTCCTGAAGGACAACCACGGTCTCCTGAAGGACAACCACGGTCTGAATGCCCATGTGGCTGGATATGCCGGCAGGATATGCCGGCAAGAACACCGACGGCAAGAACACCGACGGCCAGGTGCAACAAGCCCAACAAGCGTCTGAATTCAGCCCAACAAGCGTCTGAATTCCGATGAATTCCGACGATGCCTGGTATGTAATTCCGACGATGCCTGGTATGTGGCGAGGACAACTTCGGAACCATGAAGGAACCATGAAGTGCGGAGACTACGA

Full Affymetrix probeset data:

Annotations for 1623027_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime