FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623030_at:

>probe:Drosophila_2:1623030_at:340:221; Interrogation_Position=320; Antisense; AAGTGTTCACCAGTTTTTCGATCCG
>probe:Drosophila_2:1623030_at:386:631; Interrogation_Position=341; Antisense; TCCGTTCTCTAACCATTCCGAAGAA
>probe:Drosophila_2:1623030_at:386:39; Interrogation_Position=416; Antisense; ATCTCGTTCGTCTGCTCAAAATGGA
>probe:Drosophila_2:1623030_at:144:455; Interrogation_Position=439; Antisense; GATAAGCTTAAGTGCCGTGGTCGTT
>probe:Drosophila_2:1623030_at:232:273; Interrogation_Position=530; Antisense; CATTATTTACTTGTTCAGGCAGGCA
>probe:Drosophila_2:1623030_at:101:31; Interrogation_Position=562; Antisense; ATAAACTCTAGCCATTATTCGGCCA
>probe:Drosophila_2:1623030_at:169:691; Interrogation_Position=577; Antisense; TATTCGGCCAGTGTCAGTGATCTCA
>probe:Drosophila_2:1623030_at:433:85; Interrogation_Position=592; Antisense; AGTGATCTCAGCACCATCGATTCGC
>probe:Drosophila_2:1623030_at:595:637; Interrogation_Position=608; Antisense; TCGATTCGCCAATCTCTGCGAGGAA
>probe:Drosophila_2:1623030_at:631:561; Interrogation_Position=629; Antisense; GGAACTCACCATTTCCTTCGGAAAG
>probe:Drosophila_2:1623030_at:613:391; Interrogation_Position=649; Antisense; GAAAGTGAGTCGTCCTTTTTCGGCA
>probe:Drosophila_2:1623030_at:664:299; Interrogation_Position=721; Antisense; CGCCGTATGCAAATTCGTCTTCAGA
>probe:Drosophila_2:1623030_at:100:449; Interrogation_Position=808; Antisense; GATGCCTTCATGTCCTGGAGCGATG
>probe:Drosophila_2:1623030_at:295:587; Interrogation_Position=823; Antisense; TGGAGCGATGCCCTAGACGAGATTA

Paste this into a BLAST search page for me
AAGTGTTCACCAGTTTTTCGATCCGTCCGTTCTCTAACCATTCCGAAGAAATCTCGTTCGTCTGCTCAAAATGGAGATAAGCTTAAGTGCCGTGGTCGTTCATTATTTACTTGTTCAGGCAGGCAATAAACTCTAGCCATTATTCGGCCATATTCGGCCAGTGTCAGTGATCTCAAGTGATCTCAGCACCATCGATTCGCTCGATTCGCCAATCTCTGCGAGGAAGGAACTCACCATTTCCTTCGGAAAGGAAAGTGAGTCGTCCTTTTTCGGCACGCCGTATGCAAATTCGTCTTCAGAGATGCCTTCATGTCCTGGAGCGATGTGGAGCGATGCCCTAGACGAGATTA

Full Affymetrix probeset data:

Annotations for 1623030_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720