FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623032_at:

>probe:Drosophila_2:1623032_at:422:221; Interrogation_Position=1039; Antisense; AAGTGGTTGTCCATCCAGTTGGCAC
>probe:Drosophila_2:1623032_at:391:265; Interrogation_Position=1054; Antisense; CAGTTGGCACCATCTGGGCAAAGTT
>probe:Drosophila_2:1623032_at:279:259; Interrogation_Position=1127; Antisense; CACTCGAACTTCTTTTGACAGCCAA
>probe:Drosophila_2:1623032_at:462:677; Interrogation_Position=1162; Antisense; TAGTCATTGATCTAGGGCCTCTGGC
>probe:Drosophila_2:1623032_at:596:83; Interrogation_Position=1175; Antisense; AGGGCCTCTGGCTAATTGACTTTCC
>probe:Drosophila_2:1623032_at:677:1; Interrogation_Position=1189; Antisense; ATTGACTTTCCGGTTGGGCAACTCA
>probe:Drosophila_2:1623032_at:216:653; Interrogation_Position=1224; Antisense; TAATTGCTACAAAACGTCTGCCCGT
>probe:Drosophila_2:1623032_at:708:427; Interrogation_Position=1254; Antisense; GAGTTTTGGCCTACATATTTTCCGG
>probe:Drosophila_2:1623032_at:142:561; Interrogation_Position=827; Antisense; GGAACCACTTAACTTTACCTCTGTG
>probe:Drosophila_2:1623032_at:504:195; Interrogation_Position=886; Antisense; AACTGGTGGCCCGATTAAGTCCGCT
>probe:Drosophila_2:1623032_at:422:219; Interrogation_Position=902; Antisense; AAGTCCGCTGATCTTCACGATTAAT
>probe:Drosophila_2:1623032_at:703:237; Interrogation_Position=939; Antisense; AATCTGAACGAAATCACTCTGCCCT
>probe:Drosophila_2:1623032_at:577:337; Interrogation_Position=958; Antisense; TGCCCTTCGTTTGCAACTTTAACTC
>probe:Drosophila_2:1623032_at:322:407; Interrogation_Position=996; Antisense; GACGGCTACCACTACGAGTCATTGA

Paste this into a BLAST search page for me
AAGTGGTTGTCCATCCAGTTGGCACCAGTTGGCACCATCTGGGCAAAGTTCACTCGAACTTCTTTTGACAGCCAATAGTCATTGATCTAGGGCCTCTGGCAGGGCCTCTGGCTAATTGACTTTCCATTGACTTTCCGGTTGGGCAACTCATAATTGCTACAAAACGTCTGCCCGTGAGTTTTGGCCTACATATTTTCCGGGGAACCACTTAACTTTACCTCTGTGAACTGGTGGCCCGATTAAGTCCGCTAAGTCCGCTGATCTTCACGATTAATAATCTGAACGAAATCACTCTGCCCTTGCCCTTCGTTTGCAACTTTAACTCGACGGCTACCACTACGAGTCATTGA

Full Affymetrix probeset data:

Annotations for 1623032_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720