FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623034_at:

>probe:Drosophila_2:1623034_at:84:301; Interrogation_Position=183; Antisense; CGCCGCCAGTGGAATCTACATGATT
>probe:Drosophila_2:1623034_at:468:131; Interrogation_Position=260; Antisense; ACCTGATCTCAGTCATCTTTTGCGA
>probe:Drosophila_2:1623034_at:4:623; Interrogation_Position=320; Antisense; TGCTGTCCGGCAACGTCAACAAGTT
>probe:Drosophila_2:1623034_at:354:213; Interrogation_Position=340; Antisense; AAGTTCAGCAGCGTGCGTCTGATCA
>probe:Drosophila_2:1623034_at:635:399; Interrogation_Position=367; Antisense; GACAGCACGGTCATGGCGACCAATA
>probe:Drosophila_2:1623034_at:540:465; Interrogation_Position=39; Antisense; GTTGGGCGCGGTTGGCATAATCTTC
>probe:Drosophila_2:1623034_at:626:599; Interrogation_Position=392; Antisense; TGTTTACGGGATTCGCTACTTTTGG
>probe:Drosophila_2:1623034_at:405:613; Interrogation_Position=440; Antisense; TGAACGTGGCCTGCGGCATTGCTGT
>probe:Drosophila_2:1623034_at:518:337; Interrogation_Position=513; Antisense; GCTCTTCGTCAAGATCCTCATTGTG
>probe:Drosophila_2:1623034_at:129:427; Interrogation_Position=538; Antisense; GAGATTTTTGGCTCGGCTATCGGAC
>probe:Drosophila_2:1623034_at:448:31; Interrogation_Position=55; Antisense; ATAATCTTCGCCAACGTGATGGTCA
>probe:Drosophila_2:1623034_at:527:277; Interrogation_Position=554; Antisense; CTATCGGACTGTTTGGCCTGATTGT
>probe:Drosophila_2:1623034_at:22:605; Interrogation_Position=572; Antisense; TGATTGTGGCCATCTACATGACCTC
>probe:Drosophila_2:1623034_at:171:151; Interrogation_Position=587; Antisense; ACATGACCTCCAAGGCGGAAACCAT

Paste this into a BLAST search page for me
CGCCGCCAGTGGAATCTACATGATTACCTGATCTCAGTCATCTTTTGCGATGCTGTCCGGCAACGTCAACAAGTTAAGTTCAGCAGCGTGCGTCTGATCAGACAGCACGGTCATGGCGACCAATAGTTGGGCGCGGTTGGCATAATCTTCTGTTTACGGGATTCGCTACTTTTGGTGAACGTGGCCTGCGGCATTGCTGTGCTCTTCGTCAAGATCCTCATTGTGGAGATTTTTGGCTCGGCTATCGGACATAATCTTCGCCAACGTGATGGTCACTATCGGACTGTTTGGCCTGATTGTTGATTGTGGCCATCTACATGACCTCACATGACCTCCAAGGCGGAAACCAT

Full Affymetrix probeset data:

Annotations for 1623034_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720