Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623035_at:

>probe:Drosophila_2:1623035_at:342:31; Interrogation_Position=2091; Antisense; ATAAGGCTTATCGTCATTTTGTGTA
>probe:Drosophila_2:1623035_at:288:191; Interrogation_Position=2119; Antisense; AACTACCCGTGAATCCACTGAGTTT
>probe:Drosophila_2:1623035_at:622:429; Interrogation_Position=2138; Antisense; GAGTTTAGCATCTTTAACCTCTATA
>probe:Drosophila_2:1623035_at:36:513; Interrogation_Position=2168; Antisense; GTGAGTTGCTAACTATACCATAGGA
>probe:Drosophila_2:1623035_at:45:493; Interrogation_Position=2296; Antisense; GTAAAAGTCACTTCATGTCGGCATG
>probe:Drosophila_2:1623035_at:380:597; Interrogation_Position=2311; Antisense; TGTCGGCATGGCGTTAATCAAATAA
>probe:Drosophila_2:1623035_at:99:181; Interrogation_Position=2359; Antisense; AAAAATGCTTTGCTGCTGTCTGGGA
>probe:Drosophila_2:1623035_at:446:283; Interrogation_Position=2371; Antisense; CTGCTGTCTGGGAAAGTTTTTGCTT
>probe:Drosophila_2:1623035_at:223:477; Interrogation_Position=2386; Antisense; GTTTTTGCTTAAGCCAGGTGATTCA
>probe:Drosophila_2:1623035_at:334:531; Interrogation_Position=2402; Antisense; GGTGATTCAACTAATCCCGACTAAG
>probe:Drosophila_2:1623035_at:509:21; Interrogation_Position=2509; Antisense; ATATTTGAGTGTGACGCCACGCGAG
>probe:Drosophila_2:1623035_at:195:313; Interrogation_Position=2524; Antisense; GCCACGCGAGTACTTTTCTTTAACG
>probe:Drosophila_2:1623035_at:381:719; Interrogation_Position=2562; Antisense; TTCGCTTTATTTTTAGACATTGCTA
>probe:Drosophila_2:1623035_at:589:717; Interrogation_Position=2601; Antisense; TTCGTATTAATACTACTCCCTAAGA

Paste this into a BLAST search page for me
ATAAGGCTTATCGTCATTTTGTGTAAACTACCCGTGAATCCACTGAGTTTGAGTTTAGCATCTTTAACCTCTATAGTGAGTTGCTAACTATACCATAGGAGTAAAAGTCACTTCATGTCGGCATGTGTCGGCATGGCGTTAATCAAATAAAAAAATGCTTTGCTGCTGTCTGGGACTGCTGTCTGGGAAAGTTTTTGCTTGTTTTTGCTTAAGCCAGGTGATTCAGGTGATTCAACTAATCCCGACTAAGATATTTGAGTGTGACGCCACGCGAGGCCACGCGAGTACTTTTCTTTAACGTTCGCTTTATTTTTAGACATTGCTATTCGTATTAATACTACTCCCTAAGA

Full Affymetrix probeset data:

Annotations for 1623035_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime