Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623039_at:

>probe:Drosophila_2:1623039_at:19:159; Interrogation_Position=4610; Antisense; ACACTAGGTTACTTACATTGCACTG
>probe:Drosophila_2:1623039_at:329:617; Interrogation_Position=4628; Antisense; TGCACTGTTGAACGCCGCAAGTAGA
>probe:Drosophila_2:1623039_at:607:547; Interrogation_Position=4661; Antisense; GGAGGTACTACAAATCCGAACTGTA
>probe:Drosophila_2:1623039_at:534:659; Interrogation_Position=4777; Antisense; TAAGCCTATTCCTAAGCTCTAGCCT
>probe:Drosophila_2:1623039_at:608:115; Interrogation_Position=4791; Antisense; AGCTCTAGCCTGTAAGACTATACTT
>probe:Drosophila_2:1623039_at:363:403; Interrogation_Position=4806; Antisense; GACTATACTTGACTTGACTAATCGT
>probe:Drosophila_2:1623039_at:509:661; Interrogation_Position=4852; Antisense; TAACATATACTTACCGCACTAGGGC
>probe:Drosophila_2:1623039_at:83:357; Interrogation_Position=4867; Antisense; GCACTAGGGCAATTACTAACCGCAT
>probe:Drosophila_2:1623039_at:285:147; Interrogation_Position=4881; Antisense; ACTAACCGCATCTTTGTCTAGACAA
>probe:Drosophila_2:1623039_at:480:343; Interrogation_Position=4937; Antisense; GCATCACTGCCAGGTGCAAACGGGT
>probe:Drosophila_2:1623039_at:517:533; Interrogation_Position=4959; Antisense; GGTCCCTCAATTGTCTTCTTTACAA
>probe:Drosophila_2:1623039_at:622:641; Interrogation_Position=5001; Antisense; TTAATTGCCTTACATTTCGTACGAA
>probe:Drosophila_2:1623039_at:446:645; Interrogation_Position=5118; Antisense; TCTTTGGAGCATTTGTTTGTACATC
>probe:Drosophila_2:1623039_at:632:489; Interrogation_Position=5136; Antisense; GTACATCAAACGTCACGGATCCGAA

Paste this into a BLAST search page for me
ACACTAGGTTACTTACATTGCACTGTGCACTGTTGAACGCCGCAAGTAGAGGAGGTACTACAAATCCGAACTGTATAAGCCTATTCCTAAGCTCTAGCCTAGCTCTAGCCTGTAAGACTATACTTGACTATACTTGACTTGACTAATCGTTAACATATACTTACCGCACTAGGGCGCACTAGGGCAATTACTAACCGCATACTAACCGCATCTTTGTCTAGACAAGCATCACTGCCAGGTGCAAACGGGTGGTCCCTCAATTGTCTTCTTTACAATTAATTGCCTTACATTTCGTACGAATCTTTGGAGCATTTGTTTGTACATCGTACATCAAACGTCACGGATCCGAA

Full Affymetrix probeset data:

Annotations for 1623039_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime