FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623040_at:

>probe:Drosophila_2:1623040_at:376:603; Interrogation_Position=1101; Antisense; TGTTCAAGGAGTTAGCATCACGCAA
>probe:Drosophila_2:1623040_at:648:587; Interrogation_Position=1158; Antisense; TGTACTATAACTTCGTTGGACCTGA
>probe:Drosophila_2:1623040_at:463:727; Interrogation_Position=1173; Antisense; TTGGACCTGAGGATACGCCGCACAG
>probe:Drosophila_2:1623040_at:647:319; Interrogation_Position=1189; Antisense; GCCGCACAGCATTGGTCTCAAATCA
>probe:Drosophila_2:1623040_at:548:255; Interrogation_Position=1207; Antisense; CAAATCATTTCATACGCTCACTGGC
>probe:Drosophila_2:1623040_at:409:581; Interrogation_Position=1228; Antisense; TGGCCATCCAACAAAGAGTCACAAT
>probe:Drosophila_2:1623040_at:697:195; Interrogation_Position=1259; Antisense; AACGTGGCTGCTAAAATTGACTACA
>probe:Drosophila_2:1623040_at:150:7; Interrogation_Position=1274; Antisense; ATTGACTACAATCCAGAAGCTCTTT
>probe:Drosophila_2:1623040_at:580:115; Interrogation_Position=1291; Antisense; AGCTCTTTGCCGGAAACCTAAGAAG
>probe:Drosophila_2:1623040_at:332:377; Interrogation_Position=1345; Antisense; GAAGCATCCTTTGGTGATACCCATG
>probe:Drosophila_2:1623040_at:270:75; Interrogation_Position=1413; Antisense; AGGAGTTGAACTGTGATCCCCGAAC
>probe:Drosophila_2:1623040_at:591:595; Interrogation_Position=1424; Antisense; TGTGATCCCCGAACCATTAAATTGT
>probe:Drosophila_2:1623040_at:295:605; Interrogation_Position=1453; Antisense; TGACGGTGACTTGTTGGATCCAAAT
>probe:Drosophila_2:1623040_at:6:605; Interrogation_Position=1477; Antisense; TGATACGCCCAATAACCAGGATATG

Paste this into a BLAST search page for me
TGTTCAAGGAGTTAGCATCACGCAATGTACTATAACTTCGTTGGACCTGATTGGACCTGAGGATACGCCGCACAGGCCGCACAGCATTGGTCTCAAATCACAAATCATTTCATACGCTCACTGGCTGGCCATCCAACAAAGAGTCACAATAACGTGGCTGCTAAAATTGACTACAATTGACTACAATCCAGAAGCTCTTTAGCTCTTTGCCGGAAACCTAAGAAGGAAGCATCCTTTGGTGATACCCATGAGGAGTTGAACTGTGATCCCCGAACTGTGATCCCCGAACCATTAAATTGTTGACGGTGACTTGTTGGATCCAAATTGATACGCCCAATAACCAGGATATG

Full Affymetrix probeset data:

Annotations for 1623040_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720