Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623041_at:

>probe:Drosophila_2:1623041_at:146:381; Interrogation_Position=3701; Antisense; GAACCATGCGCGACTTCGATATCAA
>probe:Drosophila_2:1623041_at:675:501; Interrogation_Position=3726; Antisense; GTCGACGGATTTGAGGGCAGCTATA
>probe:Drosophila_2:1623041_at:179:123; Interrogation_Position=3752; Antisense; AGCGTAGTATCTCGGATGGCCGCAA
>probe:Drosophila_2:1623041_at:207:69; Interrogation_Position=3767; Antisense; ATGGCCGCAACATTTCTACCGAAGA
>probe:Drosophila_2:1623041_at:459:561; Interrogation_Position=3843; Antisense; GGAAGACGATGACGCACAGTCCACC
>probe:Drosophila_2:1623041_at:376:627; Interrogation_Position=3862; Antisense; TCCACCACGTATCCAGAGGACTTGG
>probe:Drosophila_2:1623041_at:524:267; Interrogation_Position=3936; Antisense; CAGGAGGCGTGCACCTAGCAGTGAA
>probe:Drosophila_2:1623041_at:467:613; Interrogation_Position=3957; Antisense; TGAAGCAGAGGATCCACAACCCAAA
>probe:Drosophila_2:1623041_at:196:421; Interrogation_Position=4045; Antisense; GAGCAGCCTGAAACGACTTTAAAAT
>probe:Drosophila_2:1623041_at:329:421; Interrogation_Position=4132; Antisense; GAGCAGCCATCCCATGAGAGTCGTA
>probe:Drosophila_2:1623041_at:468:109; Interrogation_Position=4187; Antisense; AGCAAACAGCGGAGCCAGCCAAAGT
>probe:Drosophila_2:1623041_at:109:171; Interrogation_Position=4207; Antisense; AAAGTGGATCTTTGCGTTCCCGAAG
>probe:Drosophila_2:1623041_at:385:375; Interrogation_Position=4245; Antisense; GAAGAAACCACAACCTAGTCGTAGA
>probe:Drosophila_2:1623041_at:429:485; Interrogation_Position=4265; Antisense; GTAGACTGGGAATACCTCGTACATT

Paste this into a BLAST search page for me
GAACCATGCGCGACTTCGATATCAAGTCGACGGATTTGAGGGCAGCTATAAGCGTAGTATCTCGGATGGCCGCAAATGGCCGCAACATTTCTACCGAAGAGGAAGACGATGACGCACAGTCCACCTCCACCACGTATCCAGAGGACTTGGCAGGAGGCGTGCACCTAGCAGTGAATGAAGCAGAGGATCCACAACCCAAAGAGCAGCCTGAAACGACTTTAAAATGAGCAGCCATCCCATGAGAGTCGTAAGCAAACAGCGGAGCCAGCCAAAGTAAAGTGGATCTTTGCGTTCCCGAAGGAAGAAACCACAACCTAGTCGTAGAGTAGACTGGGAATACCTCGTACATT

Full Affymetrix probeset data:

Annotations for 1623041_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime