FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623044_at:

>probe:Drosophila_2:1623044_at:282:593; Interrogation_Position=111; Antisense; TGGTGGCTACGGTCCTGTTCAGCGC
>probe:Drosophila_2:1623044_at:78:285; Interrogation_Position=125; Antisense; CTGTTCAGCGCGTCGTCTACGAGGA
>probe:Drosophila_2:1623044_at:627:51; Interrogation_Position=13; Antisense; ATGAAGTACCTGATTGTCTGCGTTA
>probe:Drosophila_2:1623044_at:145:635; Interrogation_Position=137; Antisense; TCGTCTACGAGGAGGTGCCCGCCTA
>probe:Drosophila_2:1623044_at:254:667; Interrogation_Position=19; Antisense; TACCTGATTGTCTGCGTTACCCTGG
>probe:Drosophila_2:1623044_at:186:657; Interrogation_Position=213; Antisense; TAATGGAGGAAGTGCCGCTGCCGCT
>probe:Drosophila_2:1623044_at:54:509; Interrogation_Position=259; Antisense; GTGAATCCCGGAACCTACAAGCAGT
>probe:Drosophila_2:1623044_at:230:725; Interrogation_Position=26; Antisense; TTGTCTGCGTTACCCTGGCCCTTTT
>probe:Drosophila_2:1623044_at:492:9; Interrogation_Position=289; Antisense; ATTCCCTCCTACGAGTTGGATGGCG
>probe:Drosophila_2:1623044_at:369:629; Interrogation_Position=295; Antisense; TCCTACGAGTTGGATGGCGCTCGCG
>probe:Drosophila_2:1623044_at:387:323; Interrogation_Position=311; Antisense; GCGCTCGCGGCTACGAGATCGGACA
>probe:Drosophila_2:1623044_at:369:137; Interrogation_Position=323; Antisense; ACGAGATCGGACACGGCTACGGCCA
>probe:Drosophila_2:1623044_at:165:287; Interrogation_Position=336; Antisense; CGGCTACGGCCAACGTGCTTACTAA
>probe:Drosophila_2:1623044_at:38:309; Interrogation_Position=70; Antisense; CCAGCGTACGGCAACCGTGGAGGTT

Paste this into a BLAST search page for me
TGGTGGCTACGGTCCTGTTCAGCGCCTGTTCAGCGCGTCGTCTACGAGGAATGAAGTACCTGATTGTCTGCGTTATCGTCTACGAGGAGGTGCCCGCCTATACCTGATTGTCTGCGTTACCCTGGTAATGGAGGAAGTGCCGCTGCCGCTGTGAATCCCGGAACCTACAAGCAGTTTGTCTGCGTTACCCTGGCCCTTTTATTCCCTCCTACGAGTTGGATGGCGTCCTACGAGTTGGATGGCGCTCGCGGCGCTCGCGGCTACGAGATCGGACAACGAGATCGGACACGGCTACGGCCACGGCTACGGCCAACGTGCTTACTAACCAGCGTACGGCAACCGTGGAGGTT

Full Affymetrix probeset data:

Annotations for 1623044_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720