FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623045_at:

>probe:Drosophila_2:1623045_at:200:437; Interrogation_Position=315; Antisense; GAGGATGGAGCCCTGCCGCATTATC
>probe:Drosophila_2:1623045_at:534:683; Interrogation_Position=336; Antisense; TATCTGCTCGACAGAGGCATCCAGT
>probe:Drosophila_2:1623045_at:662:311; Interrogation_Position=366; Antisense; GCCAAGGTCCTGTCCAATATGATCA
>probe:Drosophila_2:1623045_at:181:257; Interrogation_Position=437; Antisense; CAAAGTACGCGCTCAGTCAGATGCT
>probe:Drosophila_2:1623045_at:602:377; Interrogation_Position=509; Antisense; GAAGCGCATGGTCACAAAAGTCACA
>probe:Drosophila_2:1623045_at:266:203; Interrogation_Position=558; Antisense; AAGCCACCAAAGTTCGAGCGTTTCA
>probe:Drosophila_2:1623045_at:397:415; Interrogation_Position=573; Antisense; GAGCGTTTCATTCGACCCATGGGTC
>probe:Drosophila_2:1623045_at:701:375; Interrogation_Position=605; Antisense; GAAGAAGGCTCACGTTACGCATCCA
>probe:Drosophila_2:1623045_at:164:381; Interrogation_Position=630; Antisense; GAACTGAAAGCCACCTTCAATCTGC
>probe:Drosophila_2:1623045_at:59:239; Interrogation_Position=648; Antisense; AATCTGCCCATCATTGGCGTCAAGA
>probe:Drosophila_2:1623045_at:111:307; Interrogation_Position=688; Antisense; CCATGTTCACTTCCTTGGGTGTAAT
>probe:Drosophila_2:1623045_at:554:149; Interrogation_Position=739; Antisense; ACATCTCTGAGCTGGGTTTGGTAAC
>probe:Drosophila_2:1623045_at:511:525; Interrogation_Position=785; Antisense; GGGCAAATACGCTCAGGTCACGAAC
>probe:Drosophila_2:1623045_at:441:619; Interrogation_Position=841; Antisense; TGCTGCTTGTCTAACCCCGAAAATG

Paste this into a BLAST search page for me
GAGGATGGAGCCCTGCCGCATTATCTATCTGCTCGACAGAGGCATCCAGTGCCAAGGTCCTGTCCAATATGATCACAAAGTACGCGCTCAGTCAGATGCTGAAGCGCATGGTCACAAAAGTCACAAAGCCACCAAAGTTCGAGCGTTTCAGAGCGTTTCATTCGACCCATGGGTCGAAGAAGGCTCACGTTACGCATCCAGAACTGAAAGCCACCTTCAATCTGCAATCTGCCCATCATTGGCGTCAAGACCATGTTCACTTCCTTGGGTGTAATACATCTCTGAGCTGGGTTTGGTAACGGGCAAATACGCTCAGGTCACGAACTGCTGCTTGTCTAACCCCGAAAATG

Full Affymetrix probeset data:

Annotations for 1623045_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720