FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623050_at:

>probe:Drosophila_2:1623050_at:231:3; Interrogation_Position=1027; Antisense; ATTGGTGTTACCTCATGATCATTTA
>probe:Drosophila_2:1623050_at:360:467; Interrogation_Position=514; Antisense; GTTCCGAAGGCCTGGACACAAGTCA
>probe:Drosophila_2:1623050_at:272:217; Interrogation_Position=533; Antisense; AAGTCACATGGCAGATTCGTCCGGT
>probe:Drosophila_2:1623050_at:135:399; Interrogation_Position=586; Antisense; GACACGGCATGAGCTGGCCCTTTGA
>probe:Drosophila_2:1623050_at:347:577; Interrogation_Position=601; Antisense; GGCCCTTTGAGTTCCACCAGAGTAG
>probe:Drosophila_2:1623050_at:450:647; Interrogation_Position=663; Antisense; TCATCCGCCCGTATGGATTGGCAAA
>probe:Drosophila_2:1623050_at:690:305; Interrogation_Position=689; Antisense; CCTGCATACGCAATCTTATCCGAAG
>probe:Drosophila_2:1623050_at:400:705; Interrogation_Position=704; Antisense; TTATCCGAAGACTACGCGAGGCGAA
>probe:Drosophila_2:1623050_at:581:391; Interrogation_Position=726; Antisense; GAAACCCATGTTTCGGCGGATCTAA
>probe:Drosophila_2:1623050_at:51:93; Interrogation_Position=750; Antisense; AGTTACCATCAGTTGCCGGAATCTC
>probe:Drosophila_2:1623050_at:443:651; Interrogation_Position=773; Antisense; TCACAGTCACTGGTATCCGGCGGAA
>probe:Drosophila_2:1623050_at:346:313; Interrogation_Position=819; Antisense; GCCAGCTGTTCCTATGACTCTGGAA
>probe:Drosophila_2:1623050_at:18:141; Interrogation_Position=980; Antisense; ACGTGTTTCCGTATGTGCAAGCCTG
>probe:Drosophila_2:1623050_at:146:511; Interrogation_Position=994; Antisense; GTGCAAGCCTGAACCTATGCTATAA

Paste this into a BLAST search page for me
ATTGGTGTTACCTCATGATCATTTAGTTCCGAAGGCCTGGACACAAGTCAAAGTCACATGGCAGATTCGTCCGGTGACACGGCATGAGCTGGCCCTTTGAGGCCCTTTGAGTTCCACCAGAGTAGTCATCCGCCCGTATGGATTGGCAAACCTGCATACGCAATCTTATCCGAAGTTATCCGAAGACTACGCGAGGCGAAGAAACCCATGTTTCGGCGGATCTAAAGTTACCATCAGTTGCCGGAATCTCTCACAGTCACTGGTATCCGGCGGAAGCCAGCTGTTCCTATGACTCTGGAAACGTGTTTCCGTATGTGCAAGCCTGGTGCAAGCCTGAACCTATGCTATAA

Full Affymetrix probeset data:

Annotations for 1623050_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720