Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623054_at:

>probe:Drosophila_2:1623054_at:310:321; Interrogation_Position=143; Antisense; GCCCGAGTATCACTTTGCACATCAT
>probe:Drosophila_2:1623054_at:160:723; Interrogation_Position=157; Antisense; TTGCACATCATCTCTAAGCGAAGGG
>probe:Drosophila_2:1623054_at:580:49; Interrogation_Position=216; Antisense; ATGCGGACGAGGACGGACCCACTGC
>probe:Drosophila_2:1623054_at:218:693; Interrogation_Position=251; Antisense; TTTGTCTCCGCAGCTTCGAGACGGT
>probe:Drosophila_2:1623054_at:206:309; Interrogation_Position=280; Antisense; CCAATTTAGAACTGCCACTGGCCGC
>probe:Drosophila_2:1623054_at:475:141; Interrogation_Position=296; Antisense; ACTGGCCGCCATTGGCAATTGGCAA
>probe:Drosophila_2:1623054_at:67:255; Interrogation_Position=332; Antisense; CAACTGGCGAGTGGCATTTCCTTAT
>probe:Drosophila_2:1623054_at:33:71; Interrogation_Position=36; Antisense; AGGACCCAGGGTCAGCTTCAATCGG
>probe:Drosophila_2:1623054_at:533:447; Interrogation_Position=363; Antisense; GATGCCCATCCATGTCTAATTAAGC
>probe:Drosophila_2:1623054_at:68:709; Interrogation_Position=382; Antisense; TTAAGCGCAAGTCCTTTTGCTTCGC
>probe:Drosophila_2:1623054_at:60:575; Interrogation_Position=412; Antisense; GGCGGCTACAGCTACAGCCAAAGCT
>probe:Drosophila_2:1623054_at:177:173; Interrogation_Position=431; Antisense; AAAGCTATACAAAGCCGTGGCTGTT
>probe:Drosophila_2:1623054_at:94:343; Interrogation_Position=50; Antisense; GCTTCAATCGGGATGTGCACGTAAA
>probe:Drosophila_2:1623054_at:65:173; Interrogation_Position=72; Antisense; AAAGCGGATAGGTCAGTGCATGGTT

Paste this into a BLAST search page for me
GCCCGAGTATCACTTTGCACATCATTTGCACATCATCTCTAAGCGAAGGGATGCGGACGAGGACGGACCCACTGCTTTGTCTCCGCAGCTTCGAGACGGTCCAATTTAGAACTGCCACTGGCCGCACTGGCCGCCATTGGCAATTGGCAACAACTGGCGAGTGGCATTTCCTTATAGGACCCAGGGTCAGCTTCAATCGGGATGCCCATCCATGTCTAATTAAGCTTAAGCGCAAGTCCTTTTGCTTCGCGGCGGCTACAGCTACAGCCAAAGCTAAAGCTATACAAAGCCGTGGCTGTTGCTTCAATCGGGATGTGCACGTAAAAAAGCGGATAGGTCAGTGCATGGTT

Full Affymetrix probeset data:

Annotations for 1623054_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime