Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623055_at:

>probe:Drosophila_2:1623055_at:290:547; Interrogation_Position=1101; Antisense; GGATGTGCTGCGGTTTTCGATTAAG
>probe:Drosophila_2:1623055_at:96:657; Interrogation_Position=1122; Antisense; TAAGTCGAATGGTCTCTACTCCTCA
>probe:Drosophila_2:1623055_at:321:625; Interrogation_Position=1148; Antisense; TGCCCTACGTTACCATGTGGATCAT
>probe:Drosophila_2:1623055_at:187:657; Interrogation_Position=1247; Antisense; TAATGACAGGAGTGGCCGCCTTTGG
>probe:Drosophila_2:1623055_at:447:599; Interrogation_Position=1278; Antisense; TGTCTTCATGGTAGCTGCATCCTAT
>probe:Drosophila_2:1623055_at:361:345; Interrogation_Position=1376; Antisense; GCATGAAGCTCACGCCATTGGACAT
>probe:Drosophila_2:1623055_at:725:49; Interrogation_Position=1412; Antisense; ATGCTGGAACTCTGATGGCCATTAC
>probe:Drosophila_2:1623055_at:664:707; Interrogation_Position=1454; Antisense; TTACGGGCGTGGTATCACCATACTT
>probe:Drosophila_2:1623055_at:700:367; Interrogation_Position=1497; Antisense; GAATGCCACCCTCTTGGAGTGGAGA
>probe:Drosophila_2:1623055_at:417:547; Interrogation_Position=1517; Antisense; GGAGATTAGTCTTCTGGGTCGCATT
>probe:Drosophila_2:1623055_at:563:713; Interrogation_Position=1547; Antisense; TTCTTGTCGTCACGGCGATTGTGTA
>probe:Drosophila_2:1623055_at:206:589; Interrogation_Position=1566; Antisense; TGTGTATTGTATTTGGGCGTCCGGC
>probe:Drosophila_2:1623055_at:681:575; Interrogation_Position=1588; Antisense; GGCGATGTGCAACCCTTCAATGATG
>probe:Drosophila_2:1623055_at:657:545; Interrogation_Position=1635; Antisense; GGATGCCGCCTGAACATAAATGGTT

Paste this into a BLAST search page for me
GGATGTGCTGCGGTTTTCGATTAAGTAAGTCGAATGGTCTCTACTCCTCATGCCCTACGTTACCATGTGGATCATTAATGACAGGAGTGGCCGCCTTTGGTGTCTTCATGGTAGCTGCATCCTATGCATGAAGCTCACGCCATTGGACATATGCTGGAACTCTGATGGCCATTACTTACGGGCGTGGTATCACCATACTTGAATGCCACCCTCTTGGAGTGGAGAGGAGATTAGTCTTCTGGGTCGCATTTTCTTGTCGTCACGGCGATTGTGTATGTGTATTGTATTTGGGCGTCCGGCGGCGATGTGCAACCCTTCAATGATGGGATGCCGCCTGAACATAAATGGTT

Full Affymetrix probeset data:

Annotations for 1623055_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime