Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623058_at:

>probe:Drosophila_2:1623058_at:622:651; Interrogation_Position=4845; Antisense; TAATACAACACACACGATCACACAC
>probe:Drosophila_2:1623058_at:493:157; Interrogation_Position=4872; Antisense; ACACACCTGGCTTTGGCAGCTTTAT
>probe:Drosophila_2:1623058_at:546:697; Interrogation_Position=4909; Antisense; TTTAATAACCGACGGCGGGCTGAAT
>probe:Drosophila_2:1623058_at:61:331; Interrogation_Position=4923; Antisense; GCGGGCTGAATGAAAATCTGCACCA
>probe:Drosophila_2:1623058_at:105:123; Interrogation_Position=4947; Antisense; AGCGACTGCGATGTGGCGCTTTAAC
>probe:Drosophila_2:1623058_at:205:319; Interrogation_Position=4962; Antisense; GCGCTTTAACCTAATTTGCCTTAAT
>probe:Drosophila_2:1623058_at:288:595; Interrogation_Position=5038; Antisense; TGTGTTTCGAAACGCGCCGGTAAAG
>probe:Drosophila_2:1623058_at:104:365; Interrogation_Position=5077; Antisense; GAATTTTGTTCACCTACACCTATAC
>probe:Drosophila_2:1623058_at:563:403; Interrogation_Position=5120; Antisense; GACTATGTTTTCTATTCATTTTGCA
>probe:Drosophila_2:1623058_at:416:503; Interrogation_Position=5271; Antisense; GTCCTACACTTACTATTATAACCCA
>probe:Drosophila_2:1623058_at:651:599; Interrogation_Position=5311; Antisense; TTAGATCTAGGCGAGTTTAACTTTT
>probe:Drosophila_2:1623058_at:388:93; Interrogation_Position=5345; Antisense; AGTTGGTTTCATTTGTCTTTGCCTC
>probe:Drosophila_2:1623058_at:165:21; Interrogation_Position=5355; Antisense; ATTTGTCTTTGCCTCGTGTGCACCA
>probe:Drosophila_2:1623058_at:206:515; Interrogation_Position=5370; Antisense; GTGTGCACCACAACTACTTGATTTC

Paste this into a BLAST search page for me
TAATACAACACACACGATCACACACACACACCTGGCTTTGGCAGCTTTATTTTAATAACCGACGGCGGGCTGAATGCGGGCTGAATGAAAATCTGCACCAAGCGACTGCGATGTGGCGCTTTAACGCGCTTTAACCTAATTTGCCTTAATTGTGTTTCGAAACGCGCCGGTAAAGGAATTTTGTTCACCTACACCTATACGACTATGTTTTCTATTCATTTTGCAGTCCTACACTTACTATTATAACCCATTAGATCTAGGCGAGTTTAACTTTTAGTTGGTTTCATTTGTCTTTGCCTCATTTGTCTTTGCCTCGTGTGCACCAGTGTGCACCACAACTACTTGATTTC

Full Affymetrix probeset data:

Annotations for 1623058_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime