FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623060_at:

>probe:Drosophila_2:1623060_at:582:715; Interrogation_Position=291; Antisense; TTCGAGTTGGACGATGGAACCGCTC
>probe:Drosophila_2:1623060_at:491:381; Interrogation_Position=307; Antisense; GAACCGCTCGCTATGAACGTGGATA
>probe:Drosophila_2:1623060_at:31:413; Interrogation_Position=356; Antisense; GACCCTGATGGTTGTGGGCTACTAT
>probe:Drosophila_2:1623060_at:709:339; Interrogation_Position=373; Antisense; GCTACTATGCCTATCGGATGACCGA
>probe:Drosophila_2:1623060_at:150:291; Interrogation_Position=413; Antisense; CGTCTTCTACAATGCCGATCAGTTT
>probe:Drosophila_2:1623060_at:641:453; Interrogation_Position=429; Antisense; GATCAGTTTGGCTATCGACAGAATC
>probe:Drosophila_2:1623060_at:52:367; Interrogation_Position=449; Antisense; GAATCAGTCGATCACGCCGCAGGAA
>probe:Drosophila_2:1623060_at:451:73; Interrogation_Position=469; Antisense; AGGAATATCCCAATCTGCCGCGTTC
>probe:Drosophila_2:1623060_at:363:469; Interrogation_Position=490; Antisense; GTTCCATCGAGGTGCCCATGGTCAG
>probe:Drosophila_2:1623060_at:574:269; Interrogation_Position=506; Antisense; CATGGTCAGCGAGGCATCTGCGGCA
>probe:Drosophila_2:1623060_at:682:717; Interrogation_Position=557; Antisense; TTCCCAGTTCCAATCTCAGTTTCAA
>probe:Drosophila_2:1623060_at:64:237; Interrogation_Position=580; Antisense; AATCCCGTCTGGATGCCCATGGTAA
>probe:Drosophila_2:1623060_at:116:427; Interrogation_Position=664; Antisense; GAGAGTTCGTAATTGCACACCATGC
>probe:Drosophila_2:1623060_at:15:727; Interrogation_Position=701; Antisense; TTGGCTCCCTACATCGTTTTTTATA

Paste this into a BLAST search page for me
TTCGAGTTGGACGATGGAACCGCTCGAACCGCTCGCTATGAACGTGGATAGACCCTGATGGTTGTGGGCTACTATGCTACTATGCCTATCGGATGACCGACGTCTTCTACAATGCCGATCAGTTTGATCAGTTTGGCTATCGACAGAATCGAATCAGTCGATCACGCCGCAGGAAAGGAATATCCCAATCTGCCGCGTTCGTTCCATCGAGGTGCCCATGGTCAGCATGGTCAGCGAGGCATCTGCGGCATTCCCAGTTCCAATCTCAGTTTCAAAATCCCGTCTGGATGCCCATGGTAAGAGAGTTCGTAATTGCACACCATGCTTGGCTCCCTACATCGTTTTTTATA

Full Affymetrix probeset data:

Annotations for 1623060_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720