FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623061_at:

>probe:Drosophila_2:1623061_at:329:297; Interrogation_Position=1482; Antisense; CGCAGCAGGTCGTGGAGATCAGCCA
>probe:Drosophila_2:1623061_at:133:81; Interrogation_Position=1506; Antisense; AGGTGCCCAGCAGTCAGCATGTGCT
>probe:Drosophila_2:1623061_at:265:31; Interrogation_Position=1601; Antisense; ATAACTGGTCTGCTAAGGCGCTGCG
>probe:Drosophila_2:1623061_at:663:329; Interrogation_Position=1623; Antisense; GCGTGAGCAGTCACCTGGTGCCGTA
>probe:Drosophila_2:1623061_at:438:529; Interrogation_Position=1639; Antisense; GGTGCCGTACCCACAGGAACTGCTG
>probe:Drosophila_2:1623061_at:518:383; Interrogation_Position=1655; Antisense; GAACTGCTGCGTTCCAACTGGAGTA
>probe:Drosophila_2:1623061_at:46:197; Interrogation_Position=1670; Antisense; AACTGGAGTACGTCGGCCTGCTACC
>probe:Drosophila_2:1623061_at:535:627; Interrogation_Position=1715; Antisense; TCCACCAACAGCAGTGCCCGGGATG
>probe:Drosophila_2:1623061_at:351:547; Interrogation_Position=1795; Antisense; GGATGCAACCTCGTTGAGAGGCTTT
>probe:Drosophila_2:1623061_at:177:691; Interrogation_Position=1817; Antisense; TTTGGAACCATTGATGCCGCCAGGT
>probe:Drosophila_2:1623061_at:581:505; Interrogation_Position=1840; Antisense; GTCCAGTGGCATCCGAGAAGCCCAA
>probe:Drosophila_2:1623061_at:79:379; Interrogation_Position=1856; Antisense; GAAGCCCAACGCATTATTGACTACT
>probe:Drosophila_2:1623061_at:571:39; Interrogation_Position=1881; Antisense; ATCTGAAAAGCGTGCACTGCGGTTA
>probe:Drosophila_2:1623061_at:684:559; Interrogation_Position=1915; Antisense; GGAAATCCGAATGGGCTGCTAAATT

Paste this into a BLAST search page for me
CGCAGCAGGTCGTGGAGATCAGCCAAGGTGCCCAGCAGTCAGCATGTGCTATAACTGGTCTGCTAAGGCGCTGCGGCGTGAGCAGTCACCTGGTGCCGTAGGTGCCGTACCCACAGGAACTGCTGGAACTGCTGCGTTCCAACTGGAGTAAACTGGAGTACGTCGGCCTGCTACCTCCACCAACAGCAGTGCCCGGGATGGGATGCAACCTCGTTGAGAGGCTTTTTTGGAACCATTGATGCCGCCAGGTGTCCAGTGGCATCCGAGAAGCCCAAGAAGCCCAACGCATTATTGACTACTATCTGAAAAGCGTGCACTGCGGTTAGGAAATCCGAATGGGCTGCTAAATT

Full Affymetrix probeset data:

Annotations for 1623061_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720