Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623063_at:

>probe:Drosophila_2:1623063_at:286:425; Interrogation_Position=2187; Antisense; GAGAGAACATCGTTCTCCCGTAGCT
>probe:Drosophila_2:1623063_at:275:281; Interrogation_Position=2201; Antisense; CTCCCGTAGCTCTTTTTGTTGATTA
>probe:Drosophila_2:1623063_at:130:603; Interrogation_Position=2308; Antisense; TGTTTCTACGTCTATCATCAATTTG
>probe:Drosophila_2:1623063_at:19:21; Interrogation_Position=2328; Antisense; ATTTGTACATGAGCAGGCACGCGTA
>probe:Drosophila_2:1623063_at:722:657; Interrogation_Position=2375; Antisense; TAAGCTCGAGTGTATTTGAAATCCG
>probe:Drosophila_2:1623063_at:462:551; Interrogation_Position=2399; Antisense; GGAGAGAGGCCAACGAATTTCCCTA
>probe:Drosophila_2:1623063_at:248:365; Interrogation_Position=2413; Antisense; GAATTTCCCTAGCAGAGTGTCTCAC
>probe:Drosophila_2:1623063_at:619:433; Interrogation_Position=2427; Antisense; GAGTGTCTCACAGTCAGAGTTCATG
>probe:Drosophila_2:1623063_at:341:429; Interrogation_Position=2443; Antisense; GAGTTCATGGTCTGGCCTAGATCTA
>probe:Drosophila_2:1623063_at:528:493; Interrogation_Position=2510; Antisense; GTAATCTAAGTCACCACCAGTTCAT
>probe:Drosophila_2:1623063_at:270:129; Interrogation_Position=2525; Antisense; ACCAGTTCATAATCACGGCTTGTGC
>probe:Drosophila_2:1623063_at:286:275; Interrogation_Position=2543; Antisense; CTTGTGCGGCAAGGATCTCAGAGCT
>probe:Drosophila_2:1623063_at:345:527; Interrogation_Position=2573; Antisense; GGGAACTACTCACTCAATGTTGAAC
>probe:Drosophila_2:1623063_at:127:705; Interrogation_Position=2629; Antisense; TTATATACATACACACTCGCGGCAG

Paste this into a BLAST search page for me
GAGAGAACATCGTTCTCCCGTAGCTCTCCCGTAGCTCTTTTTGTTGATTATGTTTCTACGTCTATCATCAATTTGATTTGTACATGAGCAGGCACGCGTATAAGCTCGAGTGTATTTGAAATCCGGGAGAGAGGCCAACGAATTTCCCTAGAATTTCCCTAGCAGAGTGTCTCACGAGTGTCTCACAGTCAGAGTTCATGGAGTTCATGGTCTGGCCTAGATCTAGTAATCTAAGTCACCACCAGTTCATACCAGTTCATAATCACGGCTTGTGCCTTGTGCGGCAAGGATCTCAGAGCTGGGAACTACTCACTCAATGTTGAACTTATATACATACACACTCGCGGCAG

Full Affymetrix probeset data:

Annotations for 1623063_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime