FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623065_at:

>probe:Drosophila_2:1623065_at:164:461; Interrogation_Position=132; Antisense; GATTTACCGAATCCATTTCCCAACA
>probe:Drosophila_2:1623065_at:86:263; Interrogation_Position=203; Antisense; CAGCTAACATTCCTCATGGCGGTAA
>probe:Drosophila_2:1623065_at:100:321; Interrogation_Position=221; Antisense; GCGGTAAAAATCTGCCCAAGTCCAT
>probe:Drosophila_2:1623065_at:484:211; Interrogation_Position=307; Antisense; AAGAAGCTGATCTACGTCGTGGACA
>probe:Drosophila_2:1623065_at:22:587; Interrogation_Position=326; Antisense; TGGACACCTCTAATCTCTGTCAGAT
>probe:Drosophila_2:1623065_at:437:573; Interrogation_Position=361; Antisense; GGCGTTCTTTTCTATTCAATCCTCA
>probe:Drosophila_2:1623065_at:657:415; Interrogation_Position=388; Antisense; GAGCCGCGTCTGCAGCATAATACTA
>probe:Drosophila_2:1623065_at:443:145; Interrogation_Position=409; Antisense; ACTAAGATCCTGTTGGTACTGGCCA
>probe:Drosophila_2:1623065_at:142:157; Interrogation_Position=433; Antisense; AAAATGGATTACTCCTACCGCCAGA
>probe:Drosophila_2:1623065_at:519:415; Interrogation_Position=44; Antisense; GAGCGGGCAAAACGCACCTTTTGAA
>probe:Drosophila_2:1623065_at:513:391; Interrogation_Position=461; Antisense; GAAACGAGGCTCTGCTCATGCTGCA
>probe:Drosophila_2:1623065_at:129:189; Interrogation_Position=503; Antisense; AACAGATCCGCCAGCAGGTGACCAT
>probe:Drosophila_2:1623065_at:44:707; Interrogation_Position=559; Antisense; TTAGACCCCATCTACGATTGGCTGC
>probe:Drosophila_2:1623065_at:308:43; Interrogation_Position=91; Antisense; ATCGATGAGACCACGTTTTCCATGC

Paste this into a BLAST search page for me
GATTTACCGAATCCATTTCCCAACACAGCTAACATTCCTCATGGCGGTAAGCGGTAAAAATCTGCCCAAGTCCATAAGAAGCTGATCTACGTCGTGGACATGGACACCTCTAATCTCTGTCAGATGGCGTTCTTTTCTATTCAATCCTCAGAGCCGCGTCTGCAGCATAATACTAACTAAGATCCTGTTGGTACTGGCCAAAAATGGATTACTCCTACCGCCAGAGAGCGGGCAAAACGCACCTTTTGAAGAAACGAGGCTCTGCTCATGCTGCAAACAGATCCGCCAGCAGGTGACCATTTAGACCCCATCTACGATTGGCTGCATCGATGAGACCACGTTTTCCATGC

Full Affymetrix probeset data:

Annotations for 1623065_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720