FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623066_at:

>probe:Drosophila_2:1623066_at:309:703; Interrogation_Position=1014; Antisense; TTATCGCGACGGCAGGCTTTGTTTG
>probe:Drosophila_2:1623066_at:625:263; Interrogation_Position=1066; Antisense; CAGCAGTCCATCGAGTCCAAGATAC
>probe:Drosophila_2:1623066_at:300:553; Interrogation_Position=1173; Antisense; GGAGCAGATTATTCTCTGGCCCGAT
>probe:Drosophila_2:1623066_at:592:575; Interrogation_Position=1190; Antisense; GGCCCGATGTGGTGTGCCATGTCAT
>probe:Drosophila_2:1623066_at:439:61; Interrogation_Position=1208; Antisense; ATGTCATCGATGAGACCAGCCCGTT
>probe:Drosophila_2:1623066_at:451:467; Interrogation_Position=1230; Antisense; GTTGTCTCAGTTCACCACAGCGAAA
>probe:Drosophila_2:1623066_at:188:391; Interrogation_Position=1251; Antisense; GAAACTCTTCAATGCTGCCCAATTT
>probe:Drosophila_2:1623066_at:107:485; Interrogation_Position=1281; Antisense; GTATGTGTCCATTGTGGGCACTTCG
>probe:Drosophila_2:1623066_at:216:213; Interrogation_Position=1333; Antisense; AAGACGTCCTATCTGCCAAGGGAGA
>probe:Drosophila_2:1623066_at:254:331; Interrogation_Position=1371; Antisense; GCGGTTCGTCAATATCATCCATTAC
>probe:Drosophila_2:1623066_at:591:415; Interrogation_Position=1408; Antisense; GAGCGCTACATTGTCGACTACGAGA
>probe:Drosophila_2:1623066_at:402:75; Interrogation_Position=1441; Antisense; AGGACCATATCGGTGGACATGCCCA
>probe:Drosophila_2:1623066_at:245:401; Interrogation_Position=1456; Antisense; GACATGCCCATGACGAATCCGAAAA
>probe:Drosophila_2:1623066_at:721:31; Interrogation_Position=998; Antisense; ATAAGGCGGTGATCTGTTATCGCGA

Paste this into a BLAST search page for me
TTATCGCGACGGCAGGCTTTGTTTGCAGCAGTCCATCGAGTCCAAGATACGGAGCAGATTATTCTCTGGCCCGATGGCCCGATGTGGTGTGCCATGTCATATGTCATCGATGAGACCAGCCCGTTGTTGTCTCAGTTCACCACAGCGAAAGAAACTCTTCAATGCTGCCCAATTTGTATGTGTCCATTGTGGGCACTTCGAAGACGTCCTATCTGCCAAGGGAGAGCGGTTCGTCAATATCATCCATTACGAGCGCTACATTGTCGACTACGAGAAGGACCATATCGGTGGACATGCCCAGACATGCCCATGACGAATCCGAAAAATAAGGCGGTGATCTGTTATCGCGA

Full Affymetrix probeset data:

Annotations for 1623066_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720